IOVS
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ruiz, A.
Right arrow Articles by Bok, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ruiz, A.
Right arrow Articles by Bok, D.
(Investigative Ophthalmology and Visual Science. 2001;42:31-37.)
© 2001 by The Association for Research in Vision and Ophthalmology, Inc.

Genomic Organization and Mutation Analysis of the Gene Encoding Lecithin Retinol Acyltransferase in Human Retinal Pigment Epithelium

Alberto Ruiz1, Markus H. Kuehn2, Jeaneen L. Andorf2, Edwin Stone2, Gregory S. Hageman2 and Dean Bok1,3,4

1 From the Department of Neurobiology, 2 Brain Research Institute and 3 Jules Stein Eye Institute, School of Medicine, University of California, Los Angeles; and the 4 Department of Ophthalmology and Visual Sciences, The University of Iowa, Center for Macular Degeneration, Iowa City.


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PURPOSE. To determine the structure of the human lecithin retinol acyltransferase (LRAT) gene, map its chromosomal localization, and screen for mutations in humans with various hereditary retinal degenerations.

METHODS. Using DNA probes specific for LRAT, a bacterial artificial chromosome (BAC) clone containing the LRAT gene was isolated, subcloned into DNA fragments and relevant subclones characterized by sequencing. Exon–intron junctions were determined by comparison with the cDNA sequence previously published. Southern blot analysis was performed on human genomic DNA samples digested with several restriction enzymes. Fluorescence in situ hybridization (FISH) analysis of normal metaphase chromosomes derived from phytohemagglutinin (PHA) stimulated peripheral blood lymphocytes and radiation hybrid mapping were used for localization of the LRAT gene. Single-strand conformation polymorphism analysis (SSCP) was used to screen for potential mutations in patients with age-related macular degeneration, Leber congenital amaurosis, retinitis pigmentosa, and cone-rod dystrophy.

RESULTS. The human LRAT gene is organized into three exons of 219, 541, and 2058 bp and two introns of 103 and 4117 bp. Southern blot analysis of digested genomic DNA revealed a single band, suggesting a single copy of the LRAT gene. The human LRAT gene was localized to chromosome 4q31.2, a locus having no previous association with human eye disease. Additionally, the bovine LRAT homologue sequence was deduced and a general LRAT protein topology is suggested. No polymorphisms that segregated with retinal disease phenotypes were identified in 374 unrelated probands.

CONCLUSIONS. The organization of the LRAT gene, based on cDNA clones derived from the retinal pigment epithelium (RPE) has been determined. Its structure is less complex than other acyltransferases such as lecithin cholesterol acyltransferase (LCAT) and acyl CoA acyltransferase (ACAT). The absence of polymorphisms in the probands examined suggests a very low mutation level in the LRAT gene from the diseases analyzed.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Recently, we reported the characterization of cDNA clones encoding for lecithin retinol acyltransferase (LRAT), the enzyme responsible for the transformation of all-trans-retinol into all-trans-retinyl esters, in the retinal pigment epithelium (RPE) of the eye.1 In the present study, we have isolated and characterized genomic DNA clones that contain the LRAT gene and by virtue of these genomic clones, have also determined its chromosomal locus.

LRAT activity is fundamental in the continuation of the visual cycle. This important process takes place in the photoreceptor cells, and the RPE and is responsible for the generation of 11-cis-retinaldehyde, which is the chromophore for rhodopsin and the cone photopigments.2 3 The mechanism of action of LRAT suggests that an acyl group, specifically the acyl group at position sn-1 of a membrane phosphotidylcholine, is removed and transferred to all-trans retinol during the formation of all-trans retinyl esters.4 These retinyl esters are not only the storage form of all-trans-retinol (Vitamin A) but are also the substrate for the isomerohydrolase that generates 11-cis-retinol, another important intermediate in the visual cycle.5 6 In addition to RPE, LRAT is expressed in other tissues involved in processing and transport of retinol such as intestine, testis, and liver.7 8 9 Because of the relative instability of LRAT in the detergent solubilized form, its purification has represented a challenge. Nonetheless, by affinity labeling studies using LRAT specific inhibitors, its kinetic properties and substrate specificity have been well-documented.10 11

The LRAT-specific inhibitor [3H] all-trans-retinyl a-bromoacetate was used with partially purified membrane proteins from bovine RPE to detect a product of approximately 25 kDa.12 This observation was confirmed with the use of an additional LRAT-specific inhibitor N-boc-L-biocytinyl-11-aminoundecane chloromethyl ketone.1 Peptide sequences were obtained from this 25-kDa product, and its primary structure was determined by cDNA cloning and sequencing.1 Conceptual translation of the cDNAs demonstrated that in the human RPE, LRAT contains 230 amino acid residues with a calculated mass of 25.3 kDa. This predicted protein mass is in agreement with the LRAT protein detected on Western blot analysis using anti-LRAT polyclonal antibodies.1 Interestingly, comparison of the LRAT sequence with sequences deposited in GenBank database did not show homology with other proteins, particularly with other acyltransferases, including the well-characterized lecithin cholesterol acyltransferase (LCAT) and acyl-CoA: cholesterol acyltransferase (ACAT).13 14 15 16 This observation suggests that LRAT is not a splicing variant of these enzymes and is consequently the product of an independent gene.

To understand the structure of the LRAT gene, we sought to isolate genomic DNA clones containing the gene encoding LRAT to determine its intron–exon arrangement and to identify its chromosomal location. We also used this information to search for disease-causing mutations in individuals with various forms of hereditary retinal degenerations.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Isolation of a BAC Clone Encoding for the Human LRAT Gene
To identify bacterial artificial chromosome (BAC) clones containing the human LRAT gene, several oligonucleotide primer pairs were generated based on the published LRAT cDNA sequence. These primers were evaluated for their ability to amplify human genomic DNA by polymerase chain reaction (PCR). A predicted 150-bp PCR product was consistently amplified when using human genomic DNA as template and the following set of primers: Sense: 5'- AACATCCTGGTCAATCACCTGG -3'; and antisense: 5'- AAGTGCTCGCAGTTGTTCCACAGC -3'. These primers were used to screen by PCR, a commercially available arrayed BAC library (Genome Systems, St. Louis, MO) from which several positive clones were identified. Using KB-100 Magnum columns (Genome Systems), BAC DNA was isolated from one of these clones, designated BAC 417L23. The isolated BAC DNA was then digested with the restriction endonuclease SacI, and the resulting fragments were ligated into the vector pClonesure (CPG Inc., Lincoln Park, NJ) without further purification. After transformation by electroporation into E. coli TOP 10 cells (Invitrogen, San Diego, CA), colonies were grown overnight at 37°C on LB broth-based agar plates containing carbencillin (50 µg/ml). Then 95 subclones were selected at random from these plates and arrayed in a 96-well microtiter plate.

Isolation of LRAT Genomic Subclones
DNA was extracted from each of the 95 subclones by using the Wizard Plus Miniprep DNA purification system (Promega, Madison, WI). With a 96-well Bio-Dot microfiltration apparatus (Bio-Rad, Hercules, CA), 200 ng of DNA from each sample was blotted onto Hybond nylon membranes (Amersham, Piscataway, NJ) and cross-linked using a UV Stratalinker 1800 apparatus (Stratagene, La Jolla, CA). A subclone containing LRAT sequences was identified using an EcoRI DNA fragment labeled with 32P dCTP by Nick translation. This probe contained the entire LRAT coding sequence and fragments of the 5' (96 bp) and 3' (254 bp) untranslated regions (UTR). Hybridization of duplicate filters with the radioactive probe at 60°C was performed using ExpressHyb hybridization solution according to the manufacturer’s instructions (Clontech, Palo Alto, CA). After hybridization, the filters were rinsed twice at room temperature with a 2x SSC, 0.1% SDS solution for 15 minutes. High stringency washes with 0.1x SSC and 0.1% SDS at 50°C were performed for two rounds of 30 minutes each. Filters were exposed to X-ray film (Fujifilm, Stamford, CT) using an intensifying screen at -80°C.

Genomic Structure Characterization
DNA sequence analysis of LRAT subclones was performed using the fluorescence labeled dideoxy nucleotide termination method (Dye Terminator) in an ABI Model 377 automated DNA sequencer. Exonic fragments were determined by comparison of the obtained genomic sequences with the published LRAT cDNA sequence.

Chromosomal Localization
Radiation hybrid analysis was performed with the Genebridge 4 radiation hybrid panel from Research Genetics (Huntsville, AL). A pair of primers (5'AACATCCTGGTCAATCACCTGGA3' and 5'AAGTGCTCGCAGTTGTTCCACAGC3') corresponding to positions 361 to 383 and 468 to 491 of the published LRAT sequence was used for PCR amplification of radiation hybrid clones. Final reactions were electrophoresed on 6% polyacrylamide–5% glycerol gels, and after staining with silver nitrate, the presence of amplified products were scored. The data were then submitted to the Whitehead Institute Server (http://www.genome.wi.mit.edu/cgi-bin/contig/rhmapper.pl) for computational analysis and chromosomal assignment of the gene. Fluorescence in situ hybridization (FISH) was also used for the chromosomal localization of the human LRAT gene. This technique yields fluorescent signals at the same site on both chromatids of a chromosome. A probe consisting of DNA from BAC clone 417L23 was labeled with digoxigenin dUTP by Nick translation. The labeled probe was combined with sheared human genomic DNA and hybridized to normal metaphase chromosomes derived from PHA-stimulated peripheral blood lymphocytes in a solution containing 50% formamide, 10% dextran sulfate, and 2x SSC. Specific hybridization signals were detected by incubating the hybridized slides with fluoresceinated antidigoxigenin antibodies, followed by counterstaining with 4'-6' diamino-2-phenylindole (DAPI). In a second experiment, a chromosome 4 centromere specific probe was cohybridized with the human LRAT BAC clone 417L23 for reference.

Southern Blot Analysis
Ten µg of human genomic DNA per assay was digested with the restriction enzymes EcoRI (E), HindIII (H), XbaI (X), and SacI (S). Digested DNAs were electrophoresed in a 1% agarose gel and blotted to Hybond nylon membranes (Amersham). The filter membrane was hybridized with a 1026 bp EcoRI LRAT fragment containing 92 bp of 5' UTR, 690 bp of coding sequence and 254 bp of the 3' UTR. The LRAT probe was radioactively labeled with 32P-dCTP (Amersham) by Nick translation (GIBCO/BRL, Grand Island, NY). The hybridization process, washing solutions, and exposure conditions were the same as described in the characterization of LRAT genomic subclones section.

Isolation of Bovine RPE cDNAs Encoding LRAT
A fetal bovine RPE cDNA library was constructed in the Uni-ZAP XR system (Stratagene) by using polyA+ RNA obtained from cultured fetal bovine RPE cells that were maintained and harvested as described earlier.17 This cDNA library was screened with a radiolabeled 32P DNA probe, which included nucleotides -92 through 1850 of the published LRAT sequence.1 Using the Sequenase 2.0 System (Amersham), positive cDNA clones were characterized further by sequencing both strands with the dideoxy chain-termination method.

Topology
Hydropathy profiles for both bovine and human LRAT amino acid sequences were performed using the Kyte–Doolittle algorithm.18 To predict possible transmembrane domains in this protein, we also used the TMpred program developed by Hofmann and Stoffel19 with a minimum of 17 amino acids and maximum of 33 amino acids as range parameters for the formation of a transmembrane helix. This program is available at (http://ulrec3.unil.ch/sofware/TMPRED form.html).

Screening for Mutations in Patients with Retinal Degenerations
This study was approved by the Human Subjects Review Committee at the University of Iowa, and informed consent was obtained from all study participants following the tenets of the Declaration of Helsinki for human experimentation. As shown in Table 1 , 374 unrelated probands were screened for the entire coding region and the intron–exon borders of the LRAT gene. Probands were selected among clinical genotypes for which specific mutations have not yet been identified. The probands had the following clinical diagnoses: 38 with Leber congenital amaurosis, 91 with retinitis pigmentosa, 58 with cone–rod dystrophy, 93 with age-related macular degeneration, and 94 normal volunteers over 40 years of age who had no family or personal history of ocular disease. DNA from all study individuals was extracted from venous blood using a previously described protocol.20 Six primers pairs were used to amplify the entire coding sequence and exon–intron boundaries of the LRAT gene in all 374 individuals. They were: exon 1 5'CTTATCCGTCTCAATCCCCA3' and 5'GGCTGGGCAAGTTAAGCTC3'; exon 2A 5'ACCTCTCCAAGACGCCCT3' and 5'AGATGCCATAGTGGGTCAGG3'; exon 2B 5'ACCAGCTCTTTCCACCGAG3' and 5'GTAGGCGAAGTCCTCCACTG3'; exon 2C 5'TATTGTCAAAGTGGCCAGCA3' and 5'GAAGTGCTCGCAGTTGTTCC3'; exon 2D 5'AAAAGCTGCTGGGCTTTACC3' and 5'GGGAAGAGAAAAGGTCAGGG3'; and exon 3 5'TCTTCTTGGGTTTAGCCACC3' and 5'TTTACATACAGAATACACACACTGACA3'. All amplimers were analyzed using single-strand conformation polymorphism analysis (SSCP). All SSCP gels were scored independently by a minimum of two experienced investigators. Amplimers showing a bandshift were reamplified and sequenced bidirectionally using an ABI 377 automated sequencer and dye-terminator chemistry.


View this table:
[in this window]
[in a new window]
 
Table 1. Screening of Mutations in the LRAT Gene

 

    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Organization of the Human LRAT Gene
The human LRAT gene is organized into three exons separated by two introns (Fig. 1) . Comparison of the genomic sequence to those of the published hLRAT cDNA clones (GenBank database accession number: AF071510) and a human EST sequence (clone IMAGE: 664435) demonstrated that the first exon is at least 219 bp in size (Table 2) . However, the exact 5' end of the human LRAT mRNA has not yet been determined. The second exon is comprised of 541 bp and contains the initiation of translation codon ATG and approximately 78% of the LRAT coding sequence. The third exon consists of 2058 bp and contains the remaining 22% of the LRAT coding sequence and the entire 3'UTR sequence. These three exons are interrupted by a small intron of 103 bp, which is inserted one nucleotide before the translation initiation site and by a second intron of 4117 bp inserted between nucleotides 540 and 541 of the LRAT coding region.



View larger version (11K):
[in this window]
[in a new window]
 
Figure 1. Schematic representation of the human RPE LRAT gene. Top: SacI fragment derived from BAC 417L23 (~100 Kb) containing the human LRAT gene. Exons 1 to 3 are represented by black rectangles and introns by single lines. Bottom: Coding sequence is indicated by a hatched box and empty boxes represent UTRs. Numbers in parentheses indicate the size of each clone in Kb.

 

View this table:
[in this window]
[in a new window]
 
Table 2. Exon–Intron Organization of Human LRAT Gene

 
Southern Blot Analysis of Human Genomic DNA
To determine whether the LRAT gene exists in the human genome as a single copy or as multiple copies, Southern blot analysis was performed by using a specific LRAT cDNA radioactive probe on human genomic DNA digested with several restriction enzymes (Fig. 2) . Following hybridization, a single band was labeled by the LRAT probe in each lane. This suggests the presence of a single copy of the LRAT gene in the human genome.



View larger version (78K):
[in this window]
[in a new window]
 
Figure 2. Southern blot hybridization analysis of human genomic DNA with a human LRAT probe. Samples of human genomic DNA (10 µg) digested with EcoRI (E), HindIII (H), XbaI (X), and SacI (S).

 
Chromosomal Localization of the LRAT Gene
Using computational analysis of PCR products obtained from amplifications performed on clones of the Genebridge 4 radiation hybrid panel, the LRAT gene was located on the long arm of chromosome 4. A BAC DNA labeled with dUTP was used to perform FISH on human lymphocyte metaphase chromosomes (data not shown). Initial results based on size, morphology, and banding pattern of the labeled chromosomes indicated that the probe specifically hybridized to the long arm of chromosome 4. Subsequent hybridization of clone 417L23 with a chromosome 4 centromere-specific probe further confirmed the presence of the LRAT gene on chromosome 4. Measurements of 10 specifically hybridized chromosomes demonstrated that the LRAT gene is located at a position that is 69% of the distance from the centromere to the telomere of chromosome arm 4q, an area that corresponds to locus 4q31.2. A total of 80 metaphase cells were analyzed; 71 exhibited specific labeling to this region.

Comparison of Bovine and Human LRAT Sequences
Two cDNA clones were isolated following screening of a fetal bovine RPE cDNA library with a human LRAT cDNA probe. These bovine cDNA clones, designated bLRAT-clone 1 and bLRAT-clone 2 (GenBank database accession number: AF275344), contained inserts of 2.4 and 2.2 Kb respectively. We previously determined the first 24 N-terminal amino acids of bovine LRAT by direct amino acid sequencing (MKNPMLEAVSLVLEKLLFISYFKF).1 The assembled nucleotide sequence of the isolated cDNA clones contained the majority of the open reading frame of bovine LRAT in addition to several hundred bp of 3' UTR. The protein sequence deduced from the cDNA is in perfect agreement with the actual N-terminal protein sequence. The first two amino acids were not encoded by either cDNA clone. However, it is possible to deduce the missing nucleotides of the bovine sequence from the obtained N-terminal amino acid sequence as methionine is always encoded by atg, Lysine by aaa/g and the first nucleotide of Asparagine is a. (Fig. 3) .



View larger version (69K):
[in this window]
[in a new window]
 
Figure 3. Nucleotide sequence encoding the bovine LRAT protein. The predicted amino acid sequence is shown as a single letter code in uppercase and is displayed underneath each triplet. Amino acid variations between bovine (top) and human (bottom; GenBank accession numbers: AF275344 and AF071510, respectively) are represented in bold. The N-terminal of the bovine LRAT protein sequenced previously1 is underlined. The first seven nucleotides shown in the bovine sequence were not present in the cDNA clones, they have been deduced from the N-terminal peptide sequence. The "r" at the sixth position of the bovine sequence could represent either a or g. The single consensus polyadenylation site is shown in italics.

 
Alignment of the LRAT human polypeptide sequence to the bovine sequence showed an 88% amino acid identity (Fig. 3) . On the other hand, when the bovine LRAT 3' UTR nucleotide sequence was compared to its human homologue using the PCgene clustal alignment program, lower identity was found. Such findings are to be expected because of the species difference. A notable observation in this comparison was the fact that the bovine cDNA sequence was 137 nucleotides shorter than the human sequence when excluding the polyA tail. In addition, a typical polyadenylation signal, AATAAA, was found in the bovine cDNA clones.

Putative LRAT Topology
Using the TMpred program of Hofmann and Stoffel,19 in combination with hydropathy plots according to Kyte and Doolittle,18 two potential transmembrane domains can be predicted for the LRAT protein (Fig. 4) . The first putative transmembrane domain was found between residues Val-9 and Gly-31, and a second domain may be located between Leu-196 and Ile-222. These transmembrane domains were found at the same position and had the same length in both human and bovine polypeptide sequences. According to predictions of the TMpred program, both the N and C terminus of LRAT should be found in the lumen of the Endoplasmic reticulum (ER), yet the majority of the protein mass is predicted to reside in the cytosol. This domain includes the four cysteines present in the LRAT polypeptide at positions 161, 168, 182, and 208 in both human and cow. Recently, we proposed a role for Cys-161 and Cys-168 in the catalytic activity of the enzyme, based on results obtained by site- directed mutagenesis experiments.21



View larger version (43K):
[in this window]
[in a new window]
 
Figure 4. Schematic illustration of LRAT membrane topology in RPE cells. Amino acids are shown in single letter code. Cysteine residues are denoted in black. The protein is predicted to traverse the ER lipid bilayer two times.

 
Mutation Analyses
No polymorphisms that segregated with any of the disease genotypes investigated were identified in the coding region of the LRAT gene. A Glu-114/Glu (GAG-GAA) silent substitution was identified in one allele of one proband with retinitis pigmentosa, two alleles of one single normal patient, one allele in a single proband with age-related macular degeneration, and one allele in a proband with cone–rod dystrophy.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Recently, we reported the characterization of cDNAs encoding the LRAT protein in the human RPE.1 Translation of the open-reading frame of the RPE-derived cDNA indicates that LRAT is composed of 230 amino acids with a calculated mass of 25.3 kDa. In this study, we describe the genomic organization and chromosomal localization of the human LRAT gene and the cloning of its bovine homologue. Analysis of human DNA genomic clones revealed that LRAT is a single copy gene consisting of three exons and two introns. In addition, radiation hybrid mapping using the Genebridge 4 panel and FISH analysis performed on human normal metaphase chromosomes demonstrated that the LRAT gene is located on chromosome 4q31.2. No hereditary ocular disorder has been mapped to this locus. However, we considered the LRAT gene a promising candidate for unmapped retinal dystrophies based on its critical role in the visual cycle. Genetic screening of the LRAT gene in 374 patients did not provide any indication that mutations in this gene are involved in Leber congenital amaurosis, age-related macular degeneration, cone–rod dystrophy, or retinitis pigmentosa. Nonetheless, it is still possible that mutations in the LRAT gene exist in individuals with other retinal disorders, that mutations in other regions of the LRAT gene not investigated in this study (e.g., the promoter or uncharacterized 5' regions) are disease-causing, or that mutations not detected by our PCR-based assay of the coding region of the LRAT gene exist.

The LRAT gene structure differs considerably from other acyltransferases such as ACAT and LCAT. The ACAT protein is encoded by 16 exons with seven transmembrane domains distributed along its entire polypeptide and the LCAT protein with 440 amino acids is encoded by six different exons with no transmembrane domains.13 22 23 The enzymatic activities of these proteins are associated with microsomal membranes. However, in spite of carrying out similar functions, they have different substrates (e.g., retinol for LRAT, cholesterol for LCAT, and Acyl CoA for ACAT). Both LCAT and ACAT have been widely studied and their biochemical properties and mechanism of action are understood.13 15 24 25 Whereas ACAT and LCAT possess a similar molecular protein mass (~50 to 60 kDa) and some homology at the amino acid level, LRAT is a much smaller protein (~ 25 kDa) and shares no homology with these acyltransferases.

Furthermore, the predictions of LRAT topology suggest that it is simpler than the other acyltransferases. Only two transmembrane domains are predicted to traverse the ER lipid bilayer, exposing most of the protein mass in the cytosolic compartment where the catalytic site(s) has been proposed to reside.1 21 Interestingly, the LRAT protein does not possess the serine protease/lipase active site domain that is present in LCAT and ACAT. Therefore, it is likely that LRAT has a different mechanism of enzymatic activity. Currently, little is known about the LRAT active site(s) and its catalytic mechanism. We recently determined by site-directed mutagenesis that, of the four cysteines present in LRAT, Cys-161 and Cys-168 are directly involved in the catalytic activity of this enzyme.21

Comparison of the LRAT amino acid sequences reported here and sequences available in the GenBank database reveals a 12-amino acid domain (NCEHFVTYCRYG) that is highly conserved within the human and bovine LRAT sequences, a partial EST mouse sequence (clone IMAGE: 619832), the human TIG3 and rev 107 proteins,26 27 and the rat rev 107 protein.26 A high level of identity between the human and bovine LRAT amino acid sequences was found when these two sequences were aligned (88%). The homology between human and bovine LRAT supports strongly our previous observation of cross-reactivity of a protein in bovine RPE microsomal membranes with the human anti-LRAT antibodies. However, when more phylogenetically distant species such as mouse and rat were used, no reactivity between RPE cells and the anti-LRAT antibody was detected by Western blot analysis (A. Ruiz and D. Bok, unpublished results, February, 2000).

Preliminary results from Western blot analysis using native cells from bovine liver have shown that antibodies directed against LRAT recognize proteins of higher molecular mass than the 25 kDa observed in RPE. Whether these bands represent a larger variant of the LRAT protein or cross-reactivity with distinct, but related proteins, is currently unknown. Northern blot analysis has shown that tissues known to process retinoids express a 5 Kb mRNA transcript that hybridizes to LRAT cDNA probes. Taken together, these data suggest the possibility that LRAT isoforms exist. Clearly, more work at the molecular level is necessary to understand these issues related to tissue specificity.

The localization of the human LRAT gene on chromosome 4 by FISH was also supported by computer analysis performed on BAC sequences deposited in the GenBank database as part of the Human Genome Project. BAC clones AC009567 and AC027377 originating from human chromosome 4 confirmed the exon–intron structure reported in this study. In addition, the full sequences of the RPE LRAT introns are also now available.

The data presented here pave the way for a more detailed analysis of the exonic sequences of LRAT in the search for mutations in a gene that could be associated not only with eye disease but disease mechanisms in any tissues where processing of retinol or its derivatives is abnormal. These data will facilitate strategies for the study of LRAT at the molecular level in other species.


    Footnotes
 
Supported by NIH Grants EY06463 and EY11515 (GSH), EY10539 (ES), EY00444 and EY00331 (DB), the Foundation Fighting Blindness, the Carver Charitable Trust, the Ronald McDonald House Charities, and a Center Grant from the National Retinitis Pigmentosa Foundation Fighting Blindness Inc. (DB). DB is the Dolly Green Professor of Ophthalmology at UCLA and a Research to Prevent Blindness Senior Scientific Investigator. GSH is the recipient of a Research to Prevent Blindness Lew Wasserman merit award.

Submitted for publication July 20, 2000; revised September 19, 2000; accepted September 22, 2000.

Commercial relationships policy: N.

Corresponding author: Dean Bok, Jules Stein Eye Institute, 100 Stein Plaza, Rm. B-182, UCLA School of Medicine, Los Angeles, CA 90095. bok{at}jsei.ucla.edu


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Ruiz, A, Winston, A, Lim, YH, et al (1999) Molecular and biochemical characterization of lecithin retinol acyltransferase J Biol Chem 274,3834-3841[Abstract/Free Full Text]
  2. Ross, AC, Hammerling, VL. (1994) Sporn, MB Roberts, AB Goodman, DS eds. The Retinoids, Biology, Chemistry, and Medicine ,521-543 Raven Press New York.
  3. Saari, JC (1994) Retinoids in photosensitive systems Sporn, MB Roberts, AB Goodman, DS eds. The Retinoids, Biology, Chemistry and Medicine ,351-386 Raven Press New York.
  4. Rando, RR (1991) Membrane phospholipids as an energy source in the operation of the visual cycle Biochem 30,595-602[Medline][Order article via Infotrieve]
  5. Bernstein, PS, Law, WC, Rando, R. (1987) Isomerization of all-trans-retinoids to 11-cis-retinoids in vitro Proc Natl Acad Sci USA 84,1849-1853[Abstract/Free Full Text]
  6. Deigner, PS, Law, WC, Canada, FJ, Rando, RR (1989) Membranes as the energy source in the endergonic transformation of vitamin A to 11-cis-retinol Science 244,968-971[Abstract/Free Full Text]
  7. Saari, JC, Bredberg, DL (1989) Lecithin:retinol acyltransferase in retinal pigment epithelial microsomes J Biol Chem 264,8636-8640[Abstract/Free Full Text]
  8. MacDonald, PN, Ong, DE (1988) Lecithin-retinol acyltransferase activity in the rat small intestine J Biol Chem 263,12478-12482[Abstract/Free Full Text]
  9. Schmitt, MC, Ong, DE (1993) Expression of cellular retinol-binding protein and lecithin-retinol acyltransferase in developing rat testis Biol Reprod 49,972-979[Abstract]
  10. Barry, RJ, Canada, FJ, Rando, RR (1989) Solubilization and partial purification of retinyl ester synthetase and retinoid isomerase from bovine ocular pigment epithelium J Biol Chem 16,9231-9238
  11. Shi, YQ, Hubacek, I, Rando, RR (1993) Kinetic mechanism of lecithin retinol acyltransferase Biochem 32,1257-1263[Medline][Order article via Infotrieve]
  12. Shi, YQ, Furuyoshi, S, Hubacek, I, Rando, RR (1993) Affinity labeling of lecithin retinol acyltransferase Biochem 32,3077-3080[Medline][Order article via Infotrieve]
  13. McLean, J, Fielding, D, Drayna, D, et al (1986) Cloning and expression of human lecithin-cholesterol acyltransferase cDNA Proc Natl Acad Sci USA 83,2335-2339[Abstract/Free Full Text]
  14. Goyal, J, Wang, K, Liu, M, Subbaiah, PV (1997) Novel function of lecithin-cholesterol acyltransferase. Hydrolysis of oxidized polar phospholipids generated during lipoprotein oxidation J Biol Chem. 272,16231-16239[Abstract/Free Full Text]
  15. Oelkers, P, Behari, A, Cromley, D, et al (1998) Characterization of two human genes encoding acyl Coenzyme A: cholesterol acyltransferase-related enzymes J Biol Chem 273,26765-26771[Abstract/Free Full Text]
  16. Li, BL, Li, XL, Duan, ZJ, et al (1999) Human Acyl-CoA. Cholesterol acyltransferase-1 (ACAT-1) gene organization and evidence that the 4.3-kilobase CAT-1 mRNA is produced from two different chromosomes J Biol Chem 274,11060-11071[Abstract/Free Full Text]
  17. Bok, D, O’Day, W, Rodriguez-Boulan, E. (1992) Polarized budding of vesicular stomatitis and influenza virus from cultured human and bovine retinal pigment epithelium Exp Eye Res 55,853-860[Medline][Order article via Infotrieve]
  18. Kyte, J, Doolittle, RF (1982) A simple method for displaying the hydropathic character of a protein J Mol Biol 157,105-132[Medline][Order article via Infotrieve]
  19. Hofmann, W, Stoffel, W. (1993) A database of membrane spanning protein segments Biol Chem Hoppe-Seyler 374,166
  20. Buffone, GJ, Darlington, GJ (1985) Isolation of DNA from biological specimens without extraction with phenol Clin Chem 31,164-168[Free Full Text]
  21. Mondal, M, Ruiz, A, Bok, D, Rando, R. (2000) Lecithin retinol acyltransferase contains critical cysteines residues essential for catalysis Biochem 39,5215-5220[Medline][Order article via Infotrieve]
  22. Yang, C-Y, Manoogian, D, Pao, Q, et al (1987) Lecithin:cholesterol acyltransferase: functional regions and a structural model of the enzyme J Biol Chem 262,3086-3091[Abstract/Free Full Text]
  23. McLean, J, Wion, K, Drayna, D, et al (1986) Human lecithin-cholesterol acyltransferase gene: complete gene sequence and sites of expression Nucleic Acids Res 14,9397-9406[Abstract/Free Full Text]
  24. Lin, S, Cheng, D, Liu, MS, Chen, J, Chang, TY (1999) Human acyl-CoA; cholesterol acyltransferase-1 in the endoplasmic reticulum contains seven transmembrane domains J Biol Chem 274,23276-23285[Abstract/Free Full Text]
  25. Cases, S, Novak, S, Zheng, YW, et al (1998) ACAT-2, a second mammalian acyl-CoA:cholesterol acyltransferase, its cloning expression, and characterization J Biol Chem 273,26755-26764[Abstract/Free Full Text]
  26. Hajnal, A, Klemenz, R, Schafer, R. (1994) Subtraction cloning of H-rev 107, a gene specifically expressed in H-ras resistant fibroblasts Oncogene 9,479-490[Medline][Order article via Infotrieve]
  27. Disepio, D, Ghosn, C, Eckert, RL, et al (1998) Identification and characterization of a retinoid-induced class II tumor suppressor/growth regulatory gene Proc Natl Acad Sci USA 95,14811-14815[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
A. R. Moise, M. Golczak, Y. Imanishi, and K. Palczewski
Topology and Membrane Association of Lecithin: Retinol Acyltransferase
J. Biol. Chem., January 19, 2007; 282(3): 2081 - 2090.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
D. P. Simmons, M. L. Peach, J. R. Friedman, M. M.B. Green, M. C. Nicklaus, and L. M. De Luca
Evidence that sequence homologous region in LRAT-like proteins possesses anti-proliferative activity and DNA binding properties: translational implications and mechanism of action
Carcinogenesis, April 1, 2006; 27(4): 693 - 707.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. Boorjian, S. K. Tickoo, N. P. Mongan, H. Yu, D. Bok, R. R. Rando, D. M. Nanus, D. S. Scherr, and L. J. Gudas
Reduced Lecithin: Retinol Acyltransferase Expression Correlates with Increased Pathologic Tumor Stage in Bladder Cancer
Clin. Cancer Res., May 15, 2004; 10(10): 3429 - 3437.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. L. Batten, Y. Imanishi, T. Maeda, D. C. Tu, A. R. Moise, D. Bronson, D. Possin, R. N. Van Gelder, W. Baehr, and K. Palczewski
Lecithin-retinol Acyltransferase Is Essential for Accumulation of All-trans-Retinyl Esters in the Eye and in the Liver
J. Biol. Chem., March 12, 2004; 279(11): 10422 - 10432.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
A. C. Ross and R. Zolfaghari
Regulation of Hepatic Retinol Metabolism: Perspectives from Studies on Vitamin A Status
J. Nutr., January 1, 2004; 134(1): 269S - 275.
[Abstract] [Full Text] [PDF]


Home page
J. Nutr.Home page
A. C. Ross
Retinoid Production and Catabolism: Role of Diet in Regulating Retinol Esterification and Retinoic Acid Oxidation
J. Nutr., January 1, 2003; 133(1): 291S - 296.
[Abstract] [Full Text] [PDF]


Home page
CarcinogenesisHome page
D. P. Simmons, F. Andreola, and L. M. De Luca
Human melanomas of fibroblast and epithelial morphology differ widely in their ability to synthesize retinyl esters
Carcinogenesis, November 1, 2002; 23(11): 1821 - 1830.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ruiz, A.
Right arrow Articles by Bok, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ruiz, A.
Right arrow Articles by Bok, D.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS