IOVS
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maruyama, Y.
Right arrow Articles by Yue, B. Y. J. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maruyama, Y.
Right arrow Articles by Yue, B. Y. J. T.
(Investigative Ophthalmology and Visual Science. 2001;42:1980-1985.)
© 2001 by The Association for Research in Vision and Ophthalmology, Inc.

Involvement of Sp1 Elements in the Promoter Activity of Genes Affected in Keratoconus

Yasuhiro Maruyama1,2, Xinping Wang1,2, Yuhong Li1,2, Joel Sugar1 and Beatrice Y. J. T. Yue1

1 From the Department of Ophthalmology and Visual Sciences, College of Medicine, University of Illinois at Chicago.


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
PURPOSE. Keratoconus is a progressive disease that thins and scars the corneal stroma. In keratoconus corneas, levels of degradative enzymes, including lysosomal acid phosphatase (LAP) and cathepsin B, are elevated, and those of the inhibitors {alpha}1-proteinase inhibitor ({alpha}1-PI) and {alpha}2-macroglobulin ({alpha}2-M) are reduced, especially in the epithelial layer. An increased expression of the transcription factor Sp1 was also demonstrated. The role of Sp1 in regulation of the genes affected in keratoconus was examined in this study.

METHODS. DNA segments, containing 5'-flanking promoter sequences of the {alpha}1-PI, LAP, cathepsin B, and {alpha}2-M genes were ligated into the secreted alkaline phosphatase (SEAP) reporter gene vector. These constructs, along with the pSVß-galactosidase control vector, were transfected into cultured human corneal epithelial and stromal cells and skin fibroblasts. Cotransfection with the Sp1 expression vector was performed in parallel. SEAP and ß-galactosidase enzyme activities were assayed.

RESULTS. In corneal epithelial cells, as in stromal cells, {alpha}1-PI promoter activity was suppressed by cotransfection of pPacSp1. The LAP, cathepsin B, and {alpha}2-M promoters were functional in corneal cells, whereas activities of these promoters were much lower in skin fibroblasts. Cotransfection experiments indicated that the up- or downregulation of LAP, cathepsin B, and {alpha}2-M observed in keratoconus-affected corneas was not mediated by Sp1.

CONCLUSIONS. These results support the theory that the corneal epithelium, along with the stroma, is involved in keratoconus. An upstream role of Sp1 is indicated and the Sp1-mediated downregulation of the {alpha}1-PI gene may be a key event in the disease development.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Keratoconus is a slowly progressive corneal disease. Histopathologic studies have demonstrated that, in early stages, fragmentation of the epithelial basement membrane occurs, with disintegration of Bowman’s layer and fibrillation of the anterior stroma. In later stages, the central cornea is thinned, with destruction of Bowman’s layer and stromal scarring.1 2 3 Keratoconus affects 0.004% to 0.6%1 2 3 of people in the general population and leads to visual handicap in the productive second and third decades of life. No specific treatment of this almost universally bilateral disease exists, except to replace the corneal tissues by surgery when visual acuity is impaired beyond correction with contact lenses.4 5 Most cases reported are isolated, although a positive family history has been described in 6% to 8% of the cases.1 3 Keratoconus has also been associated with eye rubbing,6 contact lens wear,7 Down syndrome, atopy, and connective tissue diseases.1 2 3

The exact cause of this disease is still not clear. Previous biochemical studies by our group8 and others9 have shown that the amount of total protein present in keratoconus corneas is lower than that in normal control corneas, whereas protein synthesis proceeds normally in some cases.8 9 10 This led to the formulation of the hypothesis that the abnormality in keratoconus may lie in the degradative pathway of macromolecules.8 10 Subsequent data support the degradation hypothesis, demonstrating increased levels of degradative enzymes11 12 and decreased amounts of protease inhibitors13 14 in keratoconus specimens compared with those of normal and other disease control specimens. The defects were observed not only in the stroma, but also, and even more prominently, in the corneal epithelium, implying a role for this layer in the disease process.

The degradative enzymes found to be enhanced in corneas with keratoconus include lysosomal acid phosphatase (LAP), acid esterase, acid lipase,11 and cathepsins B and G.12 The inhibitors that are reduced include {alpha}1-proteinase inhibitor ({alpha}1-PI) and {alpha}2-macroglobulin ({alpha}2-M).13 14 The up- or downregulation of these genes was noted at both protein and mRNA levels.15 In view of the multiple gene involvement and the possibility of a coordinated gene regulation mechanism, several transcription factors were examined. Sp1 was found to be specifically upregulated in keratoconus-affected corneas.16

A putative promoter fragment of the human {alpha}1-PI gene was cloned and sequenced in our laboratory.17 It is of interest that coexpression of Sp1 in corneal stromal cells suppresses the {alpha}1-PI promoter activity,17 indicating that Sp1 upregulation may be directly related to {alpha}1-PI downregulation in corneas with keratoconus.

The present study was undertaken to determine whether in corneal epithelial cells, as in stromal cells, the {alpha}1-PI promoter is functional and Sp1 sensitivity exists. In addition, experiments were performed to examine whether altered expression of genes including LAP, cathepsin B, and {alpha}2-M in keratoconus corneas are related to the upregulated Sp1 level in both normal human corneal stromal and epithelial cells. Promoter fragments of these genes, all of which contain Sp1 sites,18 19 20 21 were cloned into reporter vectors. Their functional activities in corneal cells and skin fibroblasts were measured and the effects of Sp1 coexpression were evaluated.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Tissue Culture
Primary human corneal epithelial cells (donor age, 19 years) were purchased from Cascade Biologics, Inc. (Portland, OR). These cells were grown and maintained in supplemented medium (EpiLife HCGS; Cascade Biologics, Inc.), containing bovine pituitary extract, bovine insulin, hydrocortisone, bovine transferrin, and mouse epidermal growth factor. First- or second-passage cells were used for transfection experiments.

Corneal stromal fibroblasts were cultured from normal human corneas (donor ages: 10, 19, 35, and 44 years) obtained from the Illinois Eye Bank, Chicago. Normal human skin fibroblasts were purchased from American Type Culture Collection (Manassas, VA; donor age, 28 years) as a nonocular control cell type. These cells were grown and maintained in Dulbecco’s modified Eagle’s medium supplemented with glutamine, 10% (vol/vol) fetal calf serum, nonessential and essential amino acids, and antibiotics, as previously described.22

The tenets of the Declaration of Helsinki for research involving human subjects were followed, and the research was approved by the University of Illinois Institutional Review Board.

Construction of Promoter Fragments
DNA fragments containing the 2.7- and 1.4-kb 5'-flanking sequence of the {alpha}1-PI gene were ligated into one of the secreted alkaline phosphatase (SEAP) series vectors (pSEAP2-Basic; Clontech, Palo Alto, CA), as previously described,17 yielding p{alpha}1PI2.7-SEAP+ and p{alpha}1PI1.4-SEAP+ constructs. Promoter fragments for LAP, cathepsin B, and {alpha}2-M genes were made by long PCR, using gene-specific primers selected through the computer software (Vector NTI; InforMax, Ltd., Oxford, UK) based on the known promoter sequences.18 19 20 21 The primers for LAP (exon 1) were upstream (US), TTGTGCAGGGCAGGAACGGTA, and downstream (DS), GCGGCATCACCACCAGGTT; for cathepsin B, US, GATCCCAGGCGCGGGTTCTG, and DS, TTGGCGTTGCCGGAGCGGTT; and for {alpha}2-M, US, TCTGTAGCAAACATAGGATC, and DS, TCTGGTCCCAAACACTTCCC. All primers were synthesized by Genemed Biotechnologies, Inc. (South San Francisco, CA). The PCR products were analyzed on a 1.0% agarose gel and were cloned into a vector (pGEM-T Easy; Promega, Madison, WI). The expected sizes of the PCR products were 0.67 (-586 to +79), 0.44 (-361 to +74), and 5.77 (-5761 to +12) kb, containing two, nine, and two putative Sp1 binding sites, respectively. A shorter cathepsin B promoter region fragment (0.26 kb; -190 to +74, containing seven putative Sp1 sites) was made from the 0.44-kb cathepsin B DNA fragment by BssHII digestion.

The LAP, cathepsin B, and {alpha}2-M promoter fragments subcloned into the pGEM-T Easy vector (Promega) were ligated into the EcoRI multiple cloning sites of the pSEAP2-Basic vector (Clontech), yielding the pLAP-SEAP+, pCatB0.44-SEAP+, and p{alpha}2M-SEAP+ vectors. The shorter cathepsin B promoter fragment was ligated with HindIII linker at both ends and subcloned into multiple cloning sites of the pSEAP2-Basic vector, yielding pCatB0.26-SEAP+. Constructs were purified, partially sequenced, and restriction digested to confirm the identity and orientation of the inserts. The genes examined and constructs made in this study are summarized in Table 1 .


View this table:
[in this window]
[in a new window]
  		Table 1. Summary of the Genes Studied and Constructs Made

 
Transfection for Promoter Activity Analysis and Cotransfection with the Sp1 Expression Vector
The activity of the putative {alpha}1-PI, LAP, cathepsin B, and {alpha}2-M promoters in normal human corneal epithelial cells, corneal stromal cells, or skin fibroblasts was investigated in transient transfection assays. The promoter plasmids and pSEAP2-Basic (promoterless reporter gene vector), pSEAP2-Control (positive control, driven by the simian virus 40 early promoter), along with the pSV-ß-galactosidase control vector (Promega) used to normalize the transfection efficiency, were used in cell transfections.

The cells were plated at 40,000 cells/well on 24-well plates 24 hours before DNA transfection. They received fresh medium and were transfected 2 hours later using FuGENE 6 transfection reagent (Roche Molecular Biochemicals, Indianapolis, IN). In brief, 0.75 µg of the test plasmid (p{alpha}1PI2.7-SEAP+, p{alpha}1PI1.4-SEAP+, pLAP-SEAP+, pCatB0.44-SEAP+, pCatB0.26-SEAP+, p{alpha}2M-SEAP+, pSEAP2-Basic, or pSEAP2-Control) and 0.2 µg pSV-ß-galactosidase vector were mixed with 2.85 µl of FuGENE 6 in 100 µl serum-free medium, as recommended by the manufacturer. Another series of cells also received 0.1875 µg of the Sp1 expression vector pPacSp1 (a generous gift of Robert Tjian, University of California Berkeley). None of the test plasmids was added to cells serving as negative control cultures. The medium was collected from each well 48 hours later for SEAP assays.

For SEAP assay, 100 µl of the medium was mixed with 300 µl dilution buffer. After a 30-minute incubation at 65°C, 100-µl aliquots were mixed with 100 µl each of assay buffer and reaction buffer supplied from the kit, according to the manufacturer’s protocol (Tropix, Inc., Bedford, MA). The enzyme activity, represented by the light emission, was read for 5 seconds on a luminometer (MGM Instruments, Inc., Hamden, CT). For ß-galactosidase assays, cells harvested were lysed with 70 µl Galacto-Lysis Solution (Tropix, Inc.) and centrifuged at 14000 rpm to pellet the debris. The extract was used for measurements of ß-galactosidase activity and protein content (BCA method; Pierce, Rockford, IL). Assays were performed in triplicate, and each experiment was repeated at least three times. The ß-galactosidase activity was used to normalize the SEAP enzyme activity. The significance of the data was analyzed by two-tailed Student’s t-tests.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Functional Analysis of the {alpha}1-PI 5'-Flanking Element in Human Corneal Epithelial Cells and Their Responsiveness to Sp1 Expression
In cultured human corneal epithelial cells, DNA fragments containing 2.7 kb (p{alpha}1PI2.7-SEAP+) and 1.4 kb (p{alpha}1PI1.4-SEAP+) of the 5'-flanking sequence of the {alpha}1-PI gene were approximately 19 and 15 times more active at driving the SEAP reporter gene expression than the promoterless pSEAP2-Basic vector used to detect the basal activity (Fig. 1) . This result indicated that the {alpha}1-PI promoter sequences conferred functional activity in corneal epithelial cells. The 1.4-kb fragment was sufficient for promoter activity.



View larger version (9K):
[in this window]
[in a new window]
  		Figure 1. Relative SEAP enzyme activities in normal human corneal epithelial cells transfected with pSEAP2-Basic, p{alpha}1PI2.7-SEAP+, and p{alpha}1PI1.4-SEAP+ vectors along with the pSV-ß-galactosidase control vector in the absence or presence of Sp1 expression vector pPacSp1. Note that the activity of p{alpha}1PI2.7-SEAP+ and p{alpha}1PI1.4-SEAP+ vectors was approximately 19 and 15 times higher, respectively, than that of the pSEAP2-Basic vector. *Significantly different from data obtained from cells transfected without Sp1 coexpression (P < 0.05). The positive control, using the pSEAP2-Control vector, yielded more than an order of magnitude higher SEAP activity. The SEAP activity was normalized by ß-galactosidase enzyme activity. Data are presented as mean ± SD (n = 3). Two-tailed Student’s t-tests were used to analyze the significance of the data. Experiments were repeated four times with similar results.

 
When either the p{alpha}1PI2.7-SEAP+ or p{alpha}1PI1.4-SEAP+ construct was cotransfected with Sp1 expression vector pPacSp1 into corneal epithelial cells, the level of SEAP expression was significantly reduced (P < 0.05; Fig. 1 ).

Functional Analysis and Sp1 Responsiveness of the LAP, Cathepsin B, and {alpha}2-M 5'-Flanking Elements
In normal human corneal stromal cells, the vector that contained 0.67-kb 5'-flanking sequence of the human LAP gene (pLAP-SEAP+) had 53 times greater activity than the pSEAP2-Basic vector (Fig. 2) . Likewise, the SEAP activity in stromal cells driven by constructs containing the 0.44-kb promoter fragment of the cathepsin B gene (pCatB0.44-SEAP+) and the 5.77-kb {alpha}2-M promoter sequence (p{alpha}2M-SEAP+) was significantly higher (approximately 64- and 21-fold, respectively) than the basal expression (Figs. 3 and 4) . In contrast, pCatB0.26-SEAP+ showed little promoter activity (Fig. 3) . None of the promoter activity was modified by pPacSp1 cotransfection.



View larger version (13K):
[in this window]
[in a new window]
  		Figure 2. Relative SEAP enzyme activities in normal human corneal stromal cells and skin fibroblasts. Cells were transfected with pSEAP2-Basic and pLAP-SEAP+ vectors along with the pSV-ß-galactosidase control vector (used to normalize transfection efficiency) in the absence or presence of the Sp1 expression vector pPacSp1. In corneal stromal cells and skin fibroblasts, respectively, the activity of the pLAP-SEAP+ vector was approximately 53 and 3.3 times higher than that of the pSEAP2-Basic vector. Coexpression of Sp1 did not significantly alter the SEAP expression driven by the pLAP-SEAP+ vector. Data are presented as mean ± SD (n = 4). Experiments were repeated five times with similar results.

 


View larger version (13K):
[in this window]
[in a new window]
  		Figure 3. Relative SEAP enzyme activities in normal human corneal stromal cells and skin fibroblasts. Cells were transfected with pSEAP2-Basic and pCatB0.44-SEAP+ and/or CatB0.26-SEAP+ vectors along with pSV-ß-galactosidase control vector without or with pPacSp1. The activity of the pCatB0.44-SEAP+ vector for corneal and skin cells, respectively, were approximately 64 and 13 times higher than that of the pSEAP2-Basic vector. The pCatB0.26-SEAP+ vector was not functional in corneal stromal cells. Cotransfection with pPacSp1 did not modify the SEAP expression level by either the pCatB0.44-SEAP+ or pCatB0.26-SEAP+ vector. Data are presented as mean ± SD (n = 3). Experiments were repeated four times.

 


View larger version (13K):
[in this window]
[in a new window]
  		Figure 4. Relative SEAP enzyme activities in normal human corneal stromal cells and skin fibroblasts. Cells were transfected with pSEAP2-Basic and p{alpha}2M-SEAP+ vectors along with the pSV-ß-galactosidase control vector without or with pPacSp1. The activity of the p{alpha}2M-SEAP+ vector, for corneal and skin cells, respectively, was approximately 21 and 1.4 times higher than that of the pSEAP2-Basic vector. The activity was not significantly varied by cotransfection of pPacSp1. Data are presented as mean ± SD (n = 4). Experiments were repeated four times.

 
Compared with corneal cells, the promoter activity of the LAP, cathepsin B, and {alpha}2-M genes was much lower in skin fibroblasts (Figs. 2 3 and 4) , suggesting that there may be tissue- or cell type–specific expression of these genes.

When transfected into cultured corneal epithelial cells, the pLAP-SEAP+, pCatB0.44-SEAP+, and p{alpha}2M-SEAP+ vectors were approximately 168, 127, and 7.6 times more active, respectively, at driving SEAP reporter gene expression than the pSEAP2-Basic vector (Fig. 5) . The pCatB0.26-SEAP+ was again, as in corneal stromal cells, not functional in the epithelial cells. When cotransfected with pPacSp1, the level of SEAP expressions remained unaltered with all constructs except pCatB0.44-SEAP+, for which a significant reduction (P < 0.05) was observed (Fig. 5) .



View larger version (9K):
[in this window]
[in a new window]
  		Figure 5. Relative SEAP enzyme activities in normal human corneal epithelial cells transfected with pSEAP2-Basic, pLAP-SEAP+, pCatB0.44-SEAP+, pCatB0.26-SEAP+, and p{alpha}2M-SEAP+ vectors along with pSV-ß-galactosidase control vector in the absence or presence of pPacSp1. The activity of pLAP-SEAP+, pCatB0.44-SEAP+, pCatB0.26-SEAP+, and p{alpha}2M-SEAP+ vectors was approximately 168, 127, 3.4, and 7.6 times higher, respectively, than that of the pSEAP2-Basic vector. *Significantly different from data obtained from cells transfected without Sp1 coexpression (P < 0.05). The SEAP activity was normalized by ß-galactosidase enzyme activity. Data are presented as mean ± SD (n = 3). Two-tailed Student’s t-tests were used to analyze the significance of the data. Experiments were repeated three times with similar results.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
The thinning in corneas affected by keratoconus is believed to be due to extensive degradation of connective tissue elements contained therein.12 Studies from our laboratory have provided evidence that an increase in the net activities of serine and cysteine proteinases, such as cathepsins B and G, that have been shown to be released to the extracellular milieu23 24 25 26 and are capable of digesting gelatin, casein, and extracellular matrix elements,27 28 may be responsible for the abnormal degradative processes in keratoconus.12 The levels and activities of cathepsins B and G were elevated12 and the levels of inhibitors {alpha}1-PI and {alpha}2-M were reduced13 14 in corneas with keratoconus, presumably resulting in the increased net (a balance of enzyme and inhibitor) degradative activity detected. The biochemical abnormalities were observed both in the corneal stroma, where thinning occurs in keratoconus, and the corneal epithelium.11 12 13 14 15 An involvement of the epithelial layer in the disease has thus been surmised.

By immunostaining, Western blot analysis, and electrophoretic mobility shift assay, an upregulation of transcription factor Sp1 was observed in the stroma and the epithelium of keratoconus-affected corneas.16 It was further noted that the basal level of Sp1 expression in stromal cells cultured from eyes with keratoconus was greater than that in normal human cells,29 suggesting that the diseased corneal cells carry and retain the Sp1 abnormality, even after they are maintained in tissue culture through two passages. The Sp1 defect therefore appears to be an inborn error in keratoconus, not merely occurring secondarily as a result of other factors.

In an earlier study, we showed that an augmented level of Sp1 directly repressed the promoter activity of the {alpha}1-PI gene in corneal stromal cells.17 The present study further demonstrates a similar {alpha}1-PI downregulation conferred by Sp1 in corneal epithelial cells. These results may argue for both an epithelial involvement and an upstream role of Sp1 in the development of keratoconus. The Sp1-mediated {alpha}1-PI downregulation appears to be a key event. It is possible that in the corneal epithelium, the Sp1/{alpha}1-PI abnormality contributes to the degradation and breaks in the epithelial basement membrane zone, resulting in the earliest pathologic features30 31 seen in keratoconus. In the stroma as well, the anomaly may lead to increased degradative activity and eventual manifestation of thinning and scarring.

The current data indicate that Sp1 cotransfection confers little impact on the transcriptional regulation of the LAP, cathepsin B, and {alpha}2-M genes in corneal stromal cells. The constructs that contain the promoter fragments of these genes (Table 1) were made from sequences available in the literature.18 19 20 21 LAP is one of the lysosomal hydrolases that are involved mostly in lipid metabolism, not in turnover of protein or connective tissues. The 0.67-kb LAP promoter has no TATA and CAAT box sequences, has high GC content, two Sp1 binding sites, and a region complying with the properties of a CpG island.18 Similar to the {alpha}1-PI gene,17 the characteristics of the LAP promoter identify it as a housekeeping gene. Unlike the {alpha}1-PI gene, however, the LAP gene promoter does not respond to the Sp1 overexpression. This demonstration is in line with our previous finding that LAP activity is enhanced in both the cornea and the conjunctiva32 of eyes with keratoconus, whereas Sp1 upregulation is seen only in the former.16 33 Taking all evidence together, we suggest that the LAP abnormality in keratoconus may represent merely a microenvironmental change on the ocular surface. Perhaps environmental factors that have long been speculated to be associated with keratoconus, such as eye rubbing and contact lens wear, modify the hydrolase levels in cells both in the cornea and the conjunctiva.

The human cathepsin B promoter region also possesses high GC content and has no canonical TATA and CAAT boxes.21 Such TATA-less promoters are often activated by Sp1 and are dependent on the presence of clusters of Sp1 binding sites in the proximity of the transcription start site. Cathepsin B thus appears to be typical of an Sp1-regulating promoter.34 35 A total of nine Sp1 binding sites were identified in the 0.44-kb fragment used in our study. Electrophoretic mobility shift assays and site-directed mutagenesis studies have confirmed the involvement of multiple Sp1 sites in regulation of the cathepsin B proximal promoter.21 In this vein, it is somewhat surprising that the results indicate that cathepsin B expression in corneal stromal cells is insensitive to Sp1 coexpression and hence may not be regulated directly by Sp1. Either additional factors are required, or the regulation is through an Sp1-independent mechanism. A shorter 0.23-kb promoter fragment with seven Sp1 sites has been shown to be transactivatable by Sp1 cotransfection in Schneider’s Drosophila line 2.21 We therefore made and tested an additional construct containing a 0.26-kb promoter sequence and the same Sp1 binding sites. The functionality of this construct, however, was minimal in corneal cells.

The human {alpha}2-M gene promoter contains a TATA box. There are two potential Sp1 binding sites, although their functionality has yet to be established.20 The absence of Sp1 responsiveness of the {alpha}2-M promoter was not entirely unexpected.

In corneal epithelial cells, the 0.67-, 0.44- and 5.77-kb promoter fragments for LAP, cathepsin B, and {alpha}2-M genes were all functional. Similar to that found in stromal cells, the LAP and {alpha}2-M promoters were not Sp1 responsive. The cathepsin B promoter activity, on the other hand, was suppressed by the Sp1 cotransfection. The experiments were repeated three times, and repression was observed in every experiment. The significance of this result is unclear at present.

In conclusion, the present study demonstrates, on the basis of transient transfection assays, that among the known enzyme and inhibitor genes affected in keratoconus, only {alpha}1-PI is regulated by Sp1. The Sp1 regulation is operative in both corneal epithelial and stromal cells. These results support the epithelial involvement theory and suggest that the Sp1-mediated downregulation of the {alpha}1-PI gene may be a key event in the development of keratoconus.


   Acknowledgements
 
The authors thank Chan Boriboun for technical assistance.


   Footnotes
 
2 YM, XW, and YL contributed equally to the study. Back

Supported by Grants EY03890 and EY05628 and Core Grant EY01792 from the National Institutes of Health. BYJTY is a recipient of a Senior Scientific Investigator Award from Research to Prevent Blindness, Inc.

Submitted for publication December 8, 2000; revised March 30, 2001; accepted April 19, 2001.

Commercial relationships policy: N.

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: Beatrice Y. J. T. Yue, Department of Ophthalmology and Visual Sciences, University of Illinois at Chicago, 1855 W. Taylor Street, Chicago, IL 60612. u24184{at}uic.edu


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Krachmer, JH, Feder, RS, Belin, MW (1984) Keratoconus and related noninflammatory corneal disorders Surv Ophthalmol 28,293-322[Medline][Order article via Infotrieve]
  2. Bron, AJ (1988) Keratoconus Cornea 7,163-169[Medline][Order article via Infotrieve]
  3. Rabinowitz, YS (1998) Keratoconus Surv Ophthalmol 42,297-319[Medline][Order article via Infotrieve]
  4. Bron, AJ, Rabinowitz, YS (1996) Corneal dystrophies and keratoconus Curr Opin Ophthalmol 7,71-82[Medline][Order article via Infotrieve]
  5. Mandell, RB (1997) Contemporary management of keratoconus International Contact Lens Clinic 24,43-58
  6. Coyle, JT (1984) Keratoconus and eye rubbing Am J Ophthalmol 97,527-528[Medline][Order article via Infotrieve]
  7. Macsai, MS, Varley, GA, Krachmer, JH (1990) Development of keratoconus after contact lens wear: patient characteristics Arch Ophthalmol 108,534-538[Abstract]
  8. Yue, BYJT, Sugar, J, Benveniste, K. (1984) Heterogeneity in keratoconus: possible biochemical basis Proc Soc Exp Biol Med 175,336-341[Abstract]
  9. Critchfield, JW, Calandra, AJ, Nesburn, AB, Kenney, MC (1988) Keratoconus. I: biochemical studies of normal and keratoconus corneas Exp Eye Res 46,953-963[Medline][Order article via Infotrieve]
  10. Yue, BYJT, Sugar, J, Benveniste, K. (1985) RNA metabolism in cultures of corneal stromal cells from patients with keratoconus Proc Soc Exp Biol Med 178,126-132[Abstract]
  11. Sawaguchi, S, Yue, BYJT, Sugar, J, Gilboy, JE (1989) Lysosomal enzyme abnormalities in keratoconus Arch Ophthalmol 107,1507-1510[Abstract]
  12. Zhou, L, Sawaguchi, S, Twining, SS, et al (1998) Expression of degradative enzymes and protease inhibitors in keratoconus corneas Invest Ophthalmol Vis Sci 39,1117-1123[Abstract/Free Full Text]
  13. Sawaguchi, S, Twining, SS, Yue, BYJT, et al (1990) {alpha}1-Proteinase inhibitor levels in keratoconus Exp Eye Res 50,549-554[Medline][Order article via Infotrieve]
  14. Sawaguchi, S, Twining, SS, Yue, BYJT, et al (1994) {alpha}2-Macroglobulin levels in normal human and keratoconus corneas Invest Ophthalmol Vis Sci 35,4008-4014[Abstract/Free Full Text]
  15. Whitelock, RB, Fukuchi, T, Zhou, L. (1997) Cathepsin G, acid phosphatase, and {alpha}1-proteinase inhibitor messenger RNA levels in keratoconus corneas Invest Ophthalmol Vis Sci 38,529-534[Abstract/Free Full Text]
  16. Whitelock, RB, Li, Y, Zhou, L, Sugar, J, Yue, BYJT (1997) Expression of transcription factors in keratoconus, a cornea-thinning disease Biochem Biophys Res Commun 235,253-258[Medline][Order article via Infotrieve]
  17. Li, Y, Zhou, L, Twining, SS, Sugar, J, Yue, BYJT (1998) Involvement of Sp1 elements in the promoter activity of the {alpha}1-proteinase inhibitor gene J Biol Chem 273,9959-9965[Abstract/Free Full Text]
  18. Geier, C, von Figura, K, Pohlmann, R. (1989) Structure of the human lysosomal acid phosphatase gene Eur J Biochem 183,611-616[Medline][Order article via Infotrieve]
  19. Gong, Q, Chan, SJ, Bajkowski, AS, Steiner, DF, Frankfater, A. (1993) Characterization of the cathepsin B gene and multiple mRNAs in human tissues: evidence for alternative splicing of cathepsin B pre-mRNA DNA Cell Biol 12,299-309[Medline][Order article via Infotrieve]
  20. Matthijs, G, Devriendt, K, Cassiman, JJ, Van den Derghe, H, Marynen, P. (1992) Structure of the human {alpha}2-macroglobulin gene and its promoter Biochem Biophys Res Commun 184,596-603[Medline][Order article via Infotrieve]
  21. Yan, S, Berquin, IM, Troen, BR, Sloane, BF (2000) Transcription of human cathepsin B is mediated by Sp1 and Ets family factors in glioma DNA Cell Biol 19,79-91[Medline][Order article via Infotrieve]
  22. Yue, BYJT, Baum, JL, Silbert, JE (1979) The synthesis of glycosaminoglycans by cultures of corneal stromal cells from patients with keratoconus J Clin Invest 63,545-551
  23. Linebaugh, BE, Sameni, M, Day, NA, Sloane, BF, Keppler, D (1999) Exocytosis of active cathepsin B enzyme activity at pH 7.0: inhibition and molecular mass Eur J Biochem 264,100-109[Medline][Order article via Infotrieve]
  24. Kennett, CN, Cox, SW, Eley, BM (1997) Ultrastructural localization of cathepsin B in gingival tissue from chronic peridentitis patients Histochem J 29,727-734[Medline][Order article via Infotrieve]
  25. Gacko, M, Chyczewsko, L. (1997) Activity and localization of cathepsin B, D and G in aortic aneurysm Int Surg 82,398-402[Medline][Order article via Infotrieve]
  26. Sasaki, T, Ueno-Matsuda, E. (1993) Cysteine proteinase localization in osteoclasts: an immunocytochemical study Cell Tissue Res 271,177-179[Medline][Order article via Infotrieve]
  27. Buck, MR, Karustis, DG, Day, NA, Honn, KV, Sloane, BF (1992) Degradation of extracellular matrix proteins by human cathepsin B from normal and tumor tissues Biochem J 282,273-278
  28. Bonnefoy, A, Legrand, C. (2000) Proteolysis and subendothelial adhesive glycoproteins (fibronectin, thrombospondin, and van Willebrand factor) by plasmin, leukocyte cathepsin G and elastase Thromb Res 98,323-332[Medline][Order article via Infotrieve]
  29. Cheng EL, Li Y, Sugar J, Yue BYJT. Cell density regulated expression of transcription factor Sp1. Exp Eye Res. In press.
  30. Teng, CC (1963) Electron microscopic study of the pathology of keratoconus: part I Am J Ophthalmol 55,18-47[Medline][Order article via Infotrieve]
  31. Sawaguchi, S, Fukuchi, T, Abe, H, et al (1998) Three-dimensional scanning electron microscopic study of keratoconus corneas Arch Ophthalmol 116,62-68[Abstract/Free Full Text]
  32. Fukuchi, T, Yue, BYJT, Sugar, J, Lam, S. (1994) Lysosomal enzyme activities in conjunctival tissues from patients with keratoconus Arch Ophthalmol 12,1368-1374
  33. Maruyama, I, Zhou, L, Sugar, J, Yue, BYJT (2000) Normal expression levels of cathepsins, protease inhibitors, and Sp1 in conjunctival tissues from patients with keratoconus Curr Eye Res 21,886-890[Medline][Order article via Infotrieve]
  34. Dynan, WS, Saffer, JD, Lee, WS, Tjian, R. (1985) Transcription factor Sp1 recognizes promoter sequences from the monkey genome that are simian virus 40 promoter Proc Natl Acad Sci USA 82,4915-4919[Abstract/Free Full Text]
  35. Dynan, WS, Tjian, R. (1983) Isolation of transcription factors that discriminate between different promoters recognized by RNA polymerase II Cell 32,669-680[Medline][Order article via Infotrieve]



This article has been cited by other articles:


Home page
 IOVSHome page
D. H.-K. Ma, J.-Y. Yao, M.-T. Kuo, L.-C. See, K.-Y. Lin, S.-C. Chen, J.-K. Chen, A.-S. Chao, S.-F. Wang, and K.-K. Lin
Generation of Endostatin by Matrix Metalloproteinase and Cathepsin from Human Limbocorneal Epithelial Cells Cultivated on Amniotic Membrane
Invest. Ophthalmol. Vis. Sci., February 1, 2007; 48(2): 644 - 651.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
F. Chiambaretta, H. Nakamura, F. De Graeve, H. Sakai, G. Marceau, Y. Maruyama, D. Rigal, B. Dastugue, J. Sugar, B. Y. J. T. Yue, et al.
Kruppel-like Factor 6 (KLF6) Affects the Promoter Activity of the {alpha}1-Proteinase Inhibitor Gene
Invest. Ophthalmol. Vis. Sci., February 1, 2006; 47(2): 582 - 590.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
H. Nakamura, J. Ueda, J. Sugar, and B. Y. J. T. Yue
Developmentally Regulated Expression of Sp1 in the Mouse Cornea
Invest. Ophthalmol. Vis. Sci., November 1, 2005; 46(11): 4092 - 4096.
[Abstract] [Full Text] [PDF]

Home page
 Br. J. Ophthalmol.Home page
H Nakamura, F Riley, H Sakai, W Rademaker, B Y J T Yue, and D P Edward
Histopathological and immunohistochemical studies of lenticules after epikeratoplasty for keratoconus
Br. J. Ophthalmol., July 1, 2005; 89(7): 841 - 846.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
G. Adhikary, J. F. Crish, F. Bone, R. Gopalakrishnan, J. Lass, and R. L. Eckert
An Involucrin Promoter AP1 Transcription Factor Binding Site Is Required for Expression of Involucrin in the Corneal Epithelium In Vivo
Invest. Ophthalmol. Vis. Sci., April 1, 2005; 46(4): 1219 - 1227.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
G. Adhikary, J. Crish, J. Lass, and R. L. Eckert
Regulation of Involucrin Expression in Normal Human Corneal Epithelial Cells: A Role for Activator Protein One
Invest. Ophthalmol. Vis. Sci., April 1, 2004; 45(4): 1080 - 1087.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
F. Chiambaretta, L. Blanchon, B. Rabier, W. W.-Y. Kao, J. J. Liu, B. Dastugue, D. Rigal, and V. Sapin
Regulation of Corneal Keratin-12 Gene Expression by the Human Kruppel-like Transcription Factor 6
Invest. Ophthalmol. Vis. Sci., November 1, 2002; 43(11): 3422 - 3429.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maruyama, Y.
Right arrow Articles by Yue, B. Y. J. T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maruyama, Y.
Right arrow Articles by Yue, B. Y. J. T.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS