|
|
||||||||
From the Department of Ophthalmology, University of Heidelberg Medical School, Heidelberg, Germany.
| Abstract |
|---|
|
|
|---|
METHODS. Transcription of activin and receptors (ActR) for activin A and BMP-7 was detected by RT-PCR. Levels of marker proteins for differentiation and phosphorylation of similar to mothers against decapentaplegics (Smads) were quantified by Western blot analysis in response to BMP-7, activin A and follistatin. Transfection with antisense Smad2/3 was performed to evaluate signal transduction.
RESULTS. Activin A and receptors (ActR-I, ActR-IB, ActR-II) are transcribed in
corneal fibroblasts. Compared with TGF-ß1 or serum, activin A but not
BMP-7 increased
-smooth muscle (SM) actin and actin-binding proteins
such as SM myosin,
-actinin, and vinculin. Talin, paxillin, and
desmin were not induced and vimentin was downregulated by activin.
Activin also induced extracellular matrix proteins fibronectin and
integrin ß1. Activin-dependent accumulation of proteins was blocked
by follistatin. Regarding signal transduction, activin A induced
phosphorylation of Smad 2, and BMP-7 induced Smad 1, both of which were
inhibited by follistatin. Transfection with antisense Smad 2/3
prevented activin-induced expression and accumulation of
-SM actin.
CONCLUSIONS. TGF-ß proteins have different functions in the cornea. Activin A and TGF-ß1, but not BMP-7, are regulators of corneal keratocyte differentiation and may play a role during myofibroblast transdifferentiation. Smad 2/3 signal transduction seems to be important in the regulation of muscle-specific genes. Further investigation of Smad signaling may help to better understand the function of TGF-ß family members in the cornea.
| Introduction |
|---|
|
|
|---|
Approximately 30 related dimeric proteins belong to the TGF-ß
superfamily.8
9
Based on structural homology, at least
three major groups of proteins can be differentiated: TGF-ßs, bone
morphogenetic proteins (BMPs) and activins. The biological effects of
these cytokines are mediated by signaling through two families of
transmembranous serine-threonine kinase receptors.9
10
11
After ligand binding, a heteromeric complex is formed by a type I and a
type II receptor that initiates phosphorylation of the type I receptor
and activation of downstream signaling cascades.9
According to the different groups of TGF-ß, three classes of
receptors have been described: TGF-ß receptors (TGF-ßRs),
BMP-receptors (BMPRs) and activin receptors (ActRs). It is well
established that both the corneal epithelium and stroma express TGF-ß
receptors and that their ligands induce a variety of cellular
functions.12
13
Also, BMP-receptors and several BMPs have
been described in human corneal epithelium and
stroma.14
15
Signaling through BMPRs has been shown to
induce inflammatory mediators such as NF-
B and to modulate
apoptosis.14
Furthermore, ligands to BMPR have an effect
on fibroblast chemotaxis.16
It is presently unknown
whether the third receptor system, ActR, is expressed in the human
cornea and what function their ligands might have.
After receptor binding, phosphorylation of the type I receptor
initiates signal transduction through proteins belonging to the
"similar to mothers against decapentaplegic" (Smad)
family.17
18
On the basis of their function receptor,
activated Smad proteins can be differentiated into two groups serving
different types of receptors.17
18
Activation of one arm
of the Smad signaling pathway is induced by ActR-IB and results in
phosphorylation and subsequent nuclear translocation of Smads 2 and 3.
The other arm of the Smad signaling pathway is induced by ActR-I and
results in activation of Smads 1 and 5. Therefore, binding of TGF-ß
family members to ActRs can initiate signaling through two different
Smad pathways. This is in contrast to BMPR, which can activate only
Smads 1 and 5 and to TGF-ßR, which can activate Smads 2 and 3.
Nuclear translocation of Smad 2 in response to TGF-ß1 has recently
been shown in canine keratocytes.19
It is interesting that
this process seems to depend on cell density, which can modulate
myofibroblast differentiation.5
19
The process of
myofibroblast transdifferentiation is characterized by the expression
of muscle-specific genes such as
-actin.20
In the
cornea, myofibroblast transdifferentiation is instrumental for the
induction of scar formation and the reduction of corneal
transparency.7
21
22
23
In the present study we show that activin and several ActR are
transcribed in corneal fibroblasts. To learn about the biological
significance of the ActR system in the cornea, we have investigated two
prototype ligands (activin A and BMP-7) regarding their effect on
fibroblast differentiation. Activin A and TGF-ß 1 had similar effects
on proteins related to myofibroblast differentiation, migration, and
cell adhesion. In contrast, the effect of BMP-7 was less pronounced.
Follistatin, a protein that blocks activin receptors by binding activin
A or BMP-7, neutralized the effect of activin A and BMP-7 on activation
of intracellular signals and induction of gene
expression.24
Because these results suggest a functional
importance of Smads 2 and 3 for activin-dependent keratocyte
differentiation, we performed transfection with an antisense DNA
construct of Smad 2/3. Interruption of this signaling cascade also
blocked the effect of activin A on
-SM actin transcription, thus
confirming that the expression of muscle-specific proteins in corneal
fibroblasts is in part regulated by Smad signals.
| Materials and Methods |
|---|
|
|
|---|
-SM actin, SM myosin
(light- and heavy-chain),
-actinin, vinculin, talin, paxillin,
integrin ß1, fibronectin, desmin, and anti-mouse IgG conjugated to
FITC and keratinocyte basal medium were purchased from Sigma (St.
Louis, MO) and antibody against vimentin from Dako (Glostrup, Denmark).
Polyclonal antibodies against Smads 1 and 2 were obtained from Santa
Cruz Biotechnology (Santa Cruz, CA). Polyclonal antibody against
phospho-Smad 1 (Ser463/465) and polyclonal antibody against
phospho-Smad 2 (Ser465/467) were from Upstate Biotechnology (Lake
Placid, NY). Dulbeccos modified Eagles medium (DMEM) came from
Gibco (Grand Island, NY), and TGF-ß1 and follistatin were from R&D
(Minneapolis, MN). Recombinant activin A was a generous gift from
Yuzuru Eto (Ajinomoto Co., Inc., Kawasaki, Japan). Recombinant
BMP-7 was a generous gift from Donald Jin (Creative Biomolecules,
Hopkinton, MA).
Cell Culture
Human corneas stored for less than 24 hours in preservation
medium (Likorol; Chauvin-Opsia, Labege, France) at 4°C were used to
initiate keratocyte outgrowth cultures in DMEM with 10% fetal bovine
serum (FBS), as described.15
For experiments, cells from
passages 2 to 4 were used. Because seeding density is crucial in
relation to the status of differentiation5
19
an
intermediate density (150 cells/mm2) was used
that has been shown to allow the expression of differentiation-related
proteins such as
-SM actins response to TGF-ß.19
RNA Isolation and Reverse TranscriptionPolymerase Chain Reaction
Total RNA and mRNA was isolated from fresh, snap-frozen human
tissue samples or cultured corneal fibroblasts with a total RNA
isolation kit (RNAgents) and an mRNA purification kit (polyATtract;
both from Promega), as described.15
To minimize the risk
of contamination by genomic DNA the mRNA samples were digested by
RNase-free DNase followed by phenol-chloroform extraction and
isopropanol precipitation.
The following primers were used: activin ßA: sense, CAGGATGCCCTTGCTTTGGCTGAGA, and antisense, CCCACATGAAGCTTTCTGATCGCGT (282 bp, GenBank accession no. M13436, J03634); ActR-I: sense, GTACAATGGTAGATGGAGTGATGAT, and antisense, CATACCTGCCTTTCCCGACACAC (663 bp, GenBank L02911, Z22534); ActR-IB: sense, ACGTGTGAGACAGATGGGGCCTGC, and antisense, GCGATGATGCCTACCAGCTCCACCG (263 bp, GenBank U14722, Z22536); ActR-II: sense, ATCTAGCGAGAACTTCCTCCG, and antisense, GCCCTCACAGCAACAAAAATATAC (364 bp, GenBank D31770, M93415, X62381). (GenBank is provided by the National Center for Biotechnology Information, Bethesda, MD, and is available in the public domain at http://www.ncbi.nlm.nih.gov/genbank/)
First-strand cDNA was synthesized by M-MLV RT at 42°C. PCR was performed using 1 ng single-strand cDNA with 3 U Taq DNA polymerase in a volume of 50 µL. After predenaturation at 95°C for 3 minutes, 35 cycles were performed including denaturation at 94°C for 1 minute, annealing at 55°C for 1 minute and extension at 72°C for 1 minute followed by 2% agarose gel electrophoresis. All the PCR fragments were cloned and sequenced.
Western Blot Analysis
To investigate the effect of activin A and BMP-7 on keratocyte
differentiation, Western blot analysis were performed. Fibroblasts were
incubated in serum-free DMEM, with or without recombinant human activin
A (100 ng/mL),25
26
27
BMP-7 (200 ng/mL),28
TGF-ß1 (1 ng/mL), FGF-2 (bFGF; 100 ng/mL) or 10% FBS for 3 days and
solubilized in lysis buffer containing dithiothreitol and protease
inhibitors. Total protein (80 µg per lane) was fractionated by 10%
SDS-MOPS gels or 3 to 8% Tris-acetate gel and blotted onto
nitrocellulose membranes. Membranes were then incubated with monoclonal
antibodies against
-SM actin, SM myosin (heavy- and light-chain),
-actinin, vinculin, talin, paxillin, integrin ß1, fibronectin,
desmin, and vimentin and visualized with the ECL Western blot analysis
system. The relative intensities of the protein bands were quantified
using NIH Image software, ver. 1.62 (NIH Image is provided in the
public domain by the National Institutes of Health, Bethesda, MD, and
is available at http://www.nb.nih.ncbi.gov). Results are expressed
as a percentage of the signal obtained from serum-free control cultures
set as 100% (y-axis, Figs. 2
3
4
5
6
).
|
|
|
|
|
To investigate the effect of follistatin on activin-induced Smad activation and keratocyte differentiation, fibroblasts were incubated with 200 ng/mL follistatin for 30 minutes followed by stimulation with activin (100 ng/mL) or BMP-7 (200 ng/mL) for 30 minutes or 3 days and total protein isolation for Western blot.
Immunoprecipitation
Cultured fibroblasts were incubated in serum-free DMEM without
additives or with recombinant human activin A (100 ng/mL), TGF-ß1 (1
ng/mL), FGF-2 (100 ng/mL) or 10%FBS for 3 days and solubilized in
lysis buffer containing 50 mM Tris2Cl (pH 8.0),
150 mM NaCl, 0.02% sodium azide, 100 µg/mL phenylmethylsulfonyl
fluoride, 1 mM Na3VO4, 1%
Triton X-100, and protease inhibitor (1 tablet/30 mL buffer, Complete;
Roche). The lysate was then pelleted by brief centrifugation at 12,000
rpm. Protein concentrations in the supernatant were determined by
Bradford assay. Protein (50 µg) in 500 µL lysis buffer was
incubated with 5 µg monoclonal antibody against SM myosin (light
chain) for 1 hour at 4°C, and 30 µL protein-G agarose (Roche) was
used for protein absorption overnight according to the instructions of
the manufacturer. The agarose protein complex was then pelleted by
centrifugation at 12,000 rpm. Bound proteins from protein-G agarose
were solubilized in SDS gel loading buffer. After heating to 100°C
for 5 minutes and brief centrifugation at 12,000 rpm, samples were
subjected to Western blot analysis.
Construction of an Antisense Smad2/3 Expression Vector and Gene
Transfection
To investigate the importance of the Smad signaling
pathway for the induction of keratocyte differentiation by activin A,
we tested the effect of inhibiting Smad2/3 signaling on expression and
accumulation of
-SM actin protein. An antisense fragment of Smad2
(-1 to +199 of the coding sequence) was cloned into the
HindIII-BamHI cloning site of the pEGFP-N3 vector
(Clontech Laboratories, Palo Alto, CA) to overexpress antisense Smad
transcripts fused with enhanced green fluorescent protein (EGFP).
Constructs were confirmed by sequencing. Cultured fibroblasts were
transfected with pEGFP-anti-Smad or pEGFP (as a control) using reagents
(Lipofectamine and Plus; Gibco) for 3 hours in serum-free keratinocyte
basal medium. To ensure that only transfected cells were investigated,
we performed a selection for 3 weeks, during which transfected cells
grew in serum-containing DMEM with 150 µg/mL geneticin (G418;
Amersham) and nontransfected cells did not survive. After selection,
cells were incubated in serum-free DMEM, with or without recombinant
human activin A (100 ng/mL), for 3 days and were then solubilized for
Western blot analysis.
Northern Blot Analysis
To further confirm the effect of pEGFP-anti-Smad transfection on
transcription of the
-SM actin gene, Northern blot analysis was
performed. After transfection and 3 weeks of selection in medium
containing genetticin, 1 x 107 corneal
fibroblasts expressing either EGFP-anti-Smad or EGFP mRNA were cultured
in serum-free DMEM without additives or with recombinant human activin
A (100 ng/mL) for 1.5 hours followed by lysis with a total RNA
isolation kit (RNAgents; Promega). Total RNA (50 µg) from each sample
was separated on formaldehyde agarose gels (1%) and subsequently
blotted onto nylon membranes. The RNA blots were then hybridized in
42°C overnight with either
-SM actin or a GFP cDNA probe labeled
with digoxygenin-dUTP and subjected to DIG-detection and ECL film
exposure.
In general, all experiments were performed in triplicate.
| Results |
|---|
|
|
|---|
|
The first set of experiments shows that activin A induced the
expression of proteins that are related to myofibroblast
differentiation or alteration of cell shape in relation to the
extracellular matrix. Three of the most important proteins in this
respect are
-SM actin and SM myosin heavy and light chains, which
are markers for corneal myofibroblast
transdifferentiation.6
7
Figure 2
shows that both TGF-ß1
and activin A increase levels of
-SM actin (42 kDa; Fig. 2A
) as well
as SM myosin heavy chain (200 kDa; Fig. 2B
). Also SM myosin light chain
(20 kDa; which was investigated by immunoprecipitation and Western
blot) was strongly induced by both TGF-ß1 and activin A compared with
the control (Fig. 2C)
.
The second set of experiments shows that activin differentially induced
the expression of other proteins related to myofibroblast
differentiation.
-Actinin, an actin-bundling protein, as well as
vinculin, talin, and paxillin mediate the link between actin filaments
and extracellular matrix. In Figure 2
, we show that
-actinin (100
kDa; Fig. 2D
) and vinculin (116 kDa; Fig. 2E
) were strongly induced by
activin A, whereas serum and TGF-ß showed differential effects. In
contrast activin A had no effect on the level of talin (225 kDa; Fig. 2F
) and paxillin (68 kDa; Fig. 2G
) which were both upregulated by
serum.
In a third set of experiments we show that activin A had a different effect on cytoskeleton proteins that are not directly related to myofibroblast differentiation. The level of vimentin (57 kDa) was reduced by activin A (Fig. 3A) , whereas the level of desmin (53 kDa) remained the same (Fig. 3B) .
In a fourth set of experiments, activin also upregulated extracellular matrix proteins (fibronectin and integrin) that are essential for cell attachment. Levels of fibronectin (240 kDa) were induced by TGF-ß1, activin, and serum but inhibited by FGF-2 (Fig. 4A) . Similarly, integrin ß1 (120 kDa) was strongly augmented by TGF-ß1, activin A, and serum (Fig. 4B) .
Follistatins Inhibition of the Effect of Activin on Keratocyte
Differentiation
To confirm that the effect of activin A on keratocyte
differentiation is mediated by binding to ActR, we investigated the
effect of follistatin. Follistatin binds to activin A and specifically
blocks interaction of ActR with its ligand.24
Data shown
in Figure 5 confirm that activin A increased
-SM actin. Pretreatment with
follistatin inhibited this increase (Fig. 5)
. Furthermore, activin A
decreased vimentin levels, and pretreatment with follistatin prevented
this decrease (Fig. 5)
. Therefore, blockage of ActR-activin interaction
by follistatin inhibited the effect of activin A on keratocyte
differentiation.
Effect of BMP-7 on Keratocyte Differentiation
The effect of BMP-7 on keratocyte differentiation was studied in
comparison with that of TGF-ß, FGF-2, and serum. Data presented in
Figure 6A
show that the level of
-SM actin remained unchanged in the presence
of BMP-7 (BMP) and FGF-2 (FGF) but was significantly induced by
TGF-ß1 (TGF) or serum (ser) in comparison with serum-free medium
(co). SM myosin heavy chain remained unchanged by BMP-7 or FGF-2, but
was significantly induced by serum (Fig. 6B)
.
Phosphorylation of Smads 1 and 2 by BMP-7 and Activin A
To further investigate the signal transduction pathway induced by
BMP-7 or activin A, we studied phosphorylation of Smad 1 or 2 by
activin receptor serine-threonine kinases, which is a critical step for
the initiation of Smad-mediated transcriptional responses. Data
presented in Figure 7
show that BMP-7 (BMP) time dependently induced phosphorylation of Smad
1 and that activin A (Act) time dependently induced phosphorylation of
Smad 2. The level of phosphorylated Smads increased up to 35 minutes
and decreased at 50 minutes after addition of BMP-7 or activin A.
During the entire observation period, levels of total Smad 1 (65 kDa)
or 2 (52 kDa) remained the same (Fig. 7)
.
|
|
|
-SM actin in
cells that express Smad 2/3 proteins (EGFP; Fig. 10
). In contrast,
activin had no effect on expression of
-SM actin in fibroblasts that
contained low levels of Smad 2/3 due to transfection with the antisense
Smad2/3 construct (EGFP-AntiSmad; Fig. 10
). These results confirm that
the expression of
-SM actin in fibroblasts is modulated by activin A
through the Smad pathway.
|
| Discussion |
|---|
|
|
|---|
and three ß chains (ßA,
ßB, and ßC).29
30
Depending on the arrangement of
these chains several dimeric molecules can be formed. Dimers composed
of two ß chains are called activins, and dimers consisting of one
and one ß chain are called inhibins. Here we show transcription of
genes encoding for the ßA chain as well as several activin receptors
in corneal fibroblasts. As a prototypic molecule, we have investigated
the function of the bioactive molecule activin A that consists of two
monomeric ßA chains linked by disulfide bonds.30
Activin
A as well as follistatin belong to a regulatory system in which
follistatin inhibits receptor binding of activins-inhibins and
therefore downregulates their biological effects.24
30
Such a system functions, for example, in the ovary or the
prostate.31
32
In cultured corneal fibroblasts,
follistatin blocks the effect of activin on protein expression and
signal transduction. This suggests the possibility that the
activin-follistatin system may also be present in the cornea and could
be involved in the regulation of cellular functions.
The major function of activin A and BMP-7 is the regulation of cell
differentiation. During embryogenesis, these molecules are instrumental
for axis development and organogenesis in a variety of
species.33
In adults, activins function as hormone-type
feedback regulators in the reproductive system. They circulate in the
vasculature to regulate the release of follicle-stimulating
hormone.34
Activin A controls several aspects of
hematopoiesis25
26
27
and regulates cell differentiation in
the ovary, placenta, prostate, and testis.30
35
Furthermore, the presence of activin has be related to wound healing.
During cutaneous wounding, activin is released from the vasculature as
well as from activated monocytes and macrophages.36
Wound
fluid collected after severe burns induces the differentiation of
erythroid cells, an effect that is most likely due to activin
A.37
Finally, activin A is present in skin wounds, and its
expression in dermal keratinocytes is increased after
wounding.37
38
In the current study, activin A modulated
the levels of several differentiation-related proteins in corneal
fibroblasts. Among the proteins under investigation the expression of
-SM actin and SM-myosin was most prominently affected. Both of these
proteins are normally present in muscle cells, and their expression in
fibroblasts is indicative of a transition into an activated phenotype,
which is called myofibroblast transdifferentiation. In the cornea
-SM actin is induced in activated keratocytes within the wound but
not in neighboring cells and serves as a marker for myofibroblast
differentiation.22
23
39
This process has been shown to be
influenced by activin A in nonocular tissues. In pulmonary fibrosis,
scar formation is due to the activity of myofibroblasts, and activin A
has been observed in remodeling lesions associated with interstitial
pulmonary fibrosis.40
Furthermore, activin A increases the
number of fetal lung fibroblasts immunopositive for
-SM
actin.41
Similarly, activin modulates the growth of
vascular smooth muscle cells that also express SM actin and
myosin.42
In several studies, investigators have looked at the regulation of
-SM actin or SM-myosin in a variety of nonocular tissues, as well as
the cornea. It has been shown that wound-related cytokines such as
platelet-derived growth factor (PDGF) and FGF-2 inhibit the expression
of
-SM actin or SM-myosin, which is supported by our
results.6
43
44
In contrast, TGF-ß1 has been shown to
upregulate the expression of these proteins and to govern various
aspects of myofibroblast differentiation in the context of wound
healing.6
7
Herein, we present evidence that a second
TGF-ß family member, activin A (but not BMP-7) has similar, yet not
identical functions as TGF-ß1 on keratocyte differentiation. It is
notable that a similar common action was observed in RPE cells where
both activin A and TGF-ß seem to attenuate the effect of promitogenic
cytokines in the context of proliferative
vitreoretinopathy.45
46
The mechanism by which activin modulates the expression of
muscle-specific genes are unknown. For TGF-ß a direct effect on the
target gene has been shown and it seems therefore possible that activin
A follows a similar mechanism. Investigations of the effect of TGF-ß1
on
-SM actin gene expression have shown that the first 125 bp of the
-SM actin promoter are sufficient to confer TGF-ß
responsiveness.47
Within this region a TGF-ß control
element was identified that can also be found on the myosin promoter.
Further studies are needed to identify response elements that can be
induced by activin A. In addition to a direct mechanism, the effect of
activin A could be indirectfor example, based on interactions with
other cytokines. Corneal fibroblasts can express a variety of growth
factors including TGF-ß family members such as TGF-ß1, ß2, and
ß3 and BMP-2, -4, -5 and -7.14
15
48
Because there are
no data concerning the induction of cytokine gene expression by activin
A during postnatal life, it should be determined whether activin A can
induce expression of cytokines that modulate myofibroblast
transdifferentiation. Activin gene expression can be induced by factors
that are important in wound healing. For example, PDGF induces
expression of activin A in bone marrow cells.49
Furthermore, TGF-ß1 induces expression of activin A in differentiated
cell lines, suggesting that TGF-ß1 can stimulate the secretion of
activin A.50
This may imply that the modulating effects of
TGF-ß1 and PDGF on myofibroblast transdifferentiation could be partly
due to an induction of activin. This would also explain why some of the
effects of activin A and TGF-ß1 are similar.
The effect of other members of the TGF-ß superfamily on gene expression during differentiation seems to differ from that of activin A and TGF-ß1. Activin A and BMP-7 could not induce mesenchymal transdifferentiation in NMuMG breast epithelial cells in comparison with significant induction by TGF-ß.51 BMP-12 and -13 inhibit terminal differentiation of myofibroblasts by inhibiting the expression of myosin.52 Similarly, BMP-2 downregulates myosin and simultaneously induces markers for osteoblast differentiation.53 In the light of the high structural homology of the TGF-ß family members, as well as overlapping affinity with transmembranous receptors, the diversity of the effect of members of this family on cellular differentiation is surprising. During the recent past, signal-transduction pathways have been investigated, and these studies allow insight in the divergent modes of action of various TGF-ß family members. Although TGF-ß and activin A bind to different receptors, they use the same signal-transduction pathway consisting of Smads 2, 3, and 4.54 In response to activin A or TGF-ß, the carboxyl-terminal domains of Smads 2 and 3 are essential for phosphorylation of Smad 2/3, association with Smad 4, translocation into the nucleus, and transcriptional response.55 56 To initiate transcription of target genes, Smads have to interact with transcription factors. Smad 2 has been shown to interact with FAST-1 and Smads 3 and 4 interact with Ap 1, ATF2 or Sp 1.56 57 58 59 Furthermore, specific target genes for Smad 2 have been identified, such as ARE(Mix.2 promoter) or TARE(gscd promoter).55 60
The finding that BMP-7 causes transcriptional responses that differ
from those evoked by activin A can also be explained by the nature of
the signal-transduction cascade. BMP-7 has a specific binding affinity
to ActR-I, which activates Smads 1 and 5.61
Consequently,
transcription factors induced by BMP-7 are also different. Target
DNA-binding proteins of Smad 1 specific for BMP-induced gene
transcription are Hoxc-8, STAT, and OAZ.62
63
64
One of the
genes that are directly controlled by Smads 1 and 5 is the homeobox
gene Tlx2.61
Of note, BMP-7 induces
transcription of genes specific for
-SM actin and SM myosin heavy
chain during myofibroblast transdifferentiation in vascular smooth
muscle cells.65
This is in contrast to our findings in
corneal fibroblasts, where transcription of
-SM actin is regulated
by activin-Smad 2/3 signaling and is independent of BMP-7. This
suggests the presence of unknown mechanisms that control a cell
typedependent regulation of TGF-ß signaling. Furthermore, it is
currently not known how TGF-ß family members, such as activin A and
TGF-ß1, can have very divergent functions, although their
intracellular signals are mediated by identical Smad proteins. This
could be due in part to the modulating effect of transcriptional
repressors or activators that can modulate the activity of Smad
proteins. Coactivators, such as C BP/P300 or corepressors such as Ski
or SnoN, can regulate Smad-dependent transcriptional activity by
binding to the MH2 domain of Smads 3 and 466
67
68
. C BP,
Ski, and SnoN play important roles regarding the regulation of
transcription of numerous genes in vertebrates as well as
Drosophila. Differential expression or activation of these
regulators in association with Smad proteins may explain the diversity
of the biological effects induced by TGF-ß, activin, and
BMPs.69
Another possible explanation is that other signal
transduction pathways are used. It has been shown that TGF-ß induces
fibronectin synthesis through a c-Jun N-terminal kinasedependent,
Smad4-independent pathway.70
Whether activin A also uses
other pathways remains to be investigated. Further analysis of factors
that modulate the Smad signaling pathway should help to better
understand the function of TGF-ß family members in the cornea.
| Acknowledgements |
|---|
| Footnotes |
|---|
Submitted for publication February 26, 2001; revised July 6, 2001; accepted July 24, 2001.
Commercial relationships policy: N.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C.
1734 solely to indicate this fact.
Corresponding author: Friedrich E. Kruse, Augenklinik der Universität Heidelberg, Im Neuenheimer Feld 400, 69120 Heidelberg, Germany; friedrich_kruse{at}med.uni-heidelberg.de.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
K. Fu, M. J. Corbley, L. Sun, J. E. Friedman, F. Shan, J. L. Papadatos, D. Costa, F. Lutterodt, H. Sweigard, S. Bowes, et al. SM16, an Orally Active TGF-{beta} Type I Receptor Inhibitor Prevents Myofibroblast Induction and Vascular Fibrosis in the Rat Carotid Injury Model Arterioscler. Thromb. Vasc. Biol., April 1, 2008; 28(4): 665 - 671. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Wordinger and A. F. Clark Bone Morphogenetic Proteins and Their Receptors in the Eye Experimental Biology and Medicine, September 1, 2007; 232(8): 979 - 992. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Mouw, J. T. Connelly, C. G. Wilson, K. E. Michael, and M. E. Levenston Dynamic Compression Regulates the Expression and Synthesis of Chondrocyte-Specific Matrix Molecules in Bone Marrow Stromal Cells Stem Cells, March 1, 2007; 25(3): 655 - 663. [Abstract] [Full Text] [PDF] |
||||
![]() |
|