|
|
||||||||
1 From the Department of Molecular Genetics, Institute of Ophthalmology, London, United Kingdom; the 2 Department of Biology, and 5 Institute of Child Health, University College, London, United Kingdom; 3 The Sanger Centre, Wellcome Trust Genome Campus, Hinxton Hall, United Kingdom; 4 Moorfields Eye Hospital, London, United Kingdom; the 6 Eye Unit, Southampton General Hospital, Southampton, United Kingdom; and the 7 Departments of Ophthalmology and Medical Genetics, University of Alberta, Edmonton, Alberta, Canada.
| Abstract |
|---|
|
|
|---|
METHODS. Two large families with autosomal dominant iris hypoplasia and early-onset glaucoma, 21 probands with Axenfeld-Rieger phenotypes not attributable to PITX2 mutations, and 7 individuals with documented 6p25 cytogenetic rearrangements, were investigated by genotyping and fluorescence in situ hybridization, with markers and probes from the 6p25 region.
RESULTS. Interstitial 6p25 duplications were present in the unrelated families with iris hypoplasia, whereas an interstitial 6p25 deletion was identified in one Axenfeld-Rieger pedigree. Larger cytogenetic rearrangements, leading to trisomy or monosomy of the 6p25 region, resulted in microcornea and Rieger syndrome phenotypes, respectively. All the rearrangements encompassed FOXC1, increasing or decreasing the number of FOXC1 copies present, and appeared to correlate with the phenotypes observed.
CONCLUSIONS. These findings represent the first example of both interstitial duplications and deletions cosegregating with a human developmental disorder that is attributable to altered dose of transcription factor. The data presented provide additional evidence for the pathogenicity of altered gene dosage of FOXC1 and suggest that a common mechanism is responsible for rearrangements of 6p25.
| Introduction |
|---|
|
|
|---|
We have recently reported a large pedigree with a chromosomal duplication encompassing FOXC1, indicating that gene duplication can cause developmental disease in humans and that increased FOXC1 gene dosage is the probable mechanism responsible for the observed iris hypoplasia and glaucoma phenotype.4 Different sized duplications encompassing all three forkhead genes (FOXC1, FOXF2, and FOXQ1) on 6p25 and a telomeric deletion of 6p have also been described.5
In this article, we report additional families with a spectrum of 6p25 cytogenetic abnormalities, including one with an interstitial duplication and one with an interstitial deletion. The existence of interstitial duplications and deletions in the same chromosomal region implies a common cause of these cytogenetic abnormalities, that may be operating in other regions of the genome where forkhead genes are clustered. It also provides insight into developmental gene dosage as a cause of human disease.
| Methods |
|---|
|
|
|---|
|
|
Chromosome preparations from individuals C through I had been analyzed in several reference laboratories, and genotyping was performed to confirm the documented cytogenetic abnormalities (using markers listed in the appendix). Individuals from the Axenfeld-Rieger cohort were initially genotyped with two markers adjacent to FOXC1, D6S967, and AMO1 (forward, CTGGTAAGAAGGGTTGAGG; reverse, AGTTCCAATAGTCAACTTGCC, annealing temperature [Ta] 55°C) and any found to exhibit a single allele was genotyped with additional markers (279I9-73, forward, TGTGACTGCACTCTGAAGAACA; reverse, AGTGTGGAGTTGCATCTTGC; Ta 60°C; FM4, forward, TTTTGTATTCCCTTGGACCG-3', reverse GTACGGTTTCTCCAAGGCTG, Ta 57°C).
Fluorescence In Situ Hybridization
Fluorescence in situ hybridization (FISH) involves the hybridization of labeled DNA probes to complementary sequences on chromosome preparations and detection of the hybrids with fluorescence-labeled molecules.7
FISH represents a powerful technique for demonstrating the presence of a cytogenetic abnormality through comparison between the number of hybridization signals present in patients and control subjects. In the presence of a duplication, for instance, three signals are generally observed (two on one homologue and one on the other), compared with two signals in control subjects (one on each homologue). Background variation also occurs in the number of signals per cell, owing to factors that include incomplete synchronization of cultured cells within the cell cycle and viewing in two dimensions objects that are actually separated in three dimensions, which can lead to signal masking. For this reason, a large number of interphase nuclei were imaged from each individual studied.
FISH was performed on chromosome preparations obtained from short-term peripheral blood cultures or Epstein-Barr virustransformed lymphoblastoid cell lines, from representative individuals in pedigrees A (individuals 13, 14, and 15), B (VIII:24 and IX:5), and J (individuals 2, 3, and 4); individual F; and unaffected control subjects. Probes for FISH were prepared from chromosome 6p25 clones (Table 1) , plus FOXC1- and FOXF2-containing cosmids labeled with biotin or digoxygenin, either by nick translation or random priming. After hybridization to interphase nuclei or metaphase chromosomes, the probes were detected using fluorescein isothiocyanate avidin and rhodamine anti-digoxygenin, as described elsewhere.8 Signals were analyzed with fluorescence microscopy, a cooled charge-coupled device (CCD; Photometrics) and FISH software (Quips; Vysis, Downers Grove, IL), enabling the number of distinct signals in each interphase nucleus to be accurately determined.
|
Contig Assembly and Sequence Analysis
A PAC/BAC (P1 bacteriophage-artificial chromosome/bacterial-artificial chromosome) contig spanning FOXC1 was established using PACs isolated by screening the RPCI1 library with D6S344 (dJ118B18 and dJ135A7) and also clones sequenced at the Sanger Centre. Sequence-tagged site (STS) content mapping and sequence alignment (SeqMan II and MegAlign; DNAStar, Inc., Madison, WI) confirmed the orientation of clones and relative positions of microsatellite markers (Fig. 2)
. Sequence analysis of selected clones was performed using NIX, a web-based suite of prediction programs. These programs, which include GRAIL, Fex, HMMgene, GENSCAN, Genemark, FGene, and BLAST for DNA analysis, with additional programs for screening sequence databases, are all available from the Human Genome Mapping Project (HGMP) Web site (see Appendix).
| Results |
|---|
|
|
|---|
The screening of 21 Axenfeld-Rieger probands for 6p25 cytogenetic abnormalities identified one individual (J) with Rieger anomaly, monosomic for the interval D6S967 to 279-73, a region that includes FOXC1, but neither FOXF2 or FOXQ1. Similar genotyping results were obtained from the two other affected family members (Fig. 3) and FISH analysis of 20 metaphase chromosome spreads from each of these three affected individuals (2, 3, and 4) consistently demonstrated that the hybridization signal from clones encompassing FOXC1, but not FOXF2, was absent from one homologue (Figs. 1G 1H , Table 1 ).
|
8.5 mm compared with the normal range of 10.611.75 mm ), as well as ptosis. The axial lengths were normal and no iris hypoplasia was present (Fig. 1C)
. The four monosomic for 6p25individual F: 46XX, del (6) (p25-pter); individual G: 46XY, -6 + der (6)t (4,6) (q33;p24.2); individual H: 46XX, del (6) (p24-pter); and individual I: 46XX, -6 + der(6)t (5,6) (q34;p24)were diagnosed as Rieger syndrome. All had combinations of anterior segment developmental defects, dental abnormalities, varying degrees of hearing impairment, and developmental delay, without the umbilical abnormalities characteristically associated with this condition. Brain imaging had been conducted in only one individual (I), revealing hydrocephalus. | Discussion |
|---|
|
|
|---|
All previous reports of 6p25 cytogenetic abnormalities4 5 16 are consistent with the concept that altered dose of a gene or genes in the duplicated or deleted region results in the ocular developmental phenotype(s) observed. Although FOXC1 is the most likely candidate because of its known role in anterior segment development, the presence of adjacent forkhead genes and mapping data for the IRID1b locus2 have prevented the exclusion of alternative hypotheses. The demonstration of a duplication in a pedigree (B) in which a single recombination event appeared to exclude FOXC1 from the disease-causing interval, removes one of the two defining recombinants for the IRID1b locus.2 Difficulty interpreting the original linkage data, stemmed from the method of visualizing alleles (32P), which did not allow differences in the dose of identical-sized alleles to be easily resolved. The recombinant individual VIII:24, despite having a crossover with D6S344, has inherited a third copy of FOXC1, like all other affected individuals in pedigree B (Fig. 1E) . This situation is reminiscent of the mapping of Charcot-Marie-Tooth disease, which was also complicated by an unrecognized duplication.17 18
Confirmation that increased dose of FOXC1 is pathogenic requires recapitulation of the human phenotype in an animal model carrying an additional functional copy of FOXC1, a goal we are currently working toward. In the interim the observation of multiple FOXC1-containing interstitial cytogenetic rearrangements, which in two pedigrees (A and J) did not include other forkhead genes, coupled with data on Foxc1 from other species and the weakened case for IRID1b, suggest but do not prove, that altered dose of FOXC1 is pathogenic. Because early-onset glaucoma will develop in almost all the affected individuals in the duplication pedigrees (A and B),4
6
it appears that interstitial duplication results in a higher rate of glaucoma than either deletion or FOXC1 mutation (
50% of cases).19
In the small series of telomeric cytogenetic abnormalities presented in this article, the telomeric deletions result in Rieger syndrome, the severest phenotype in the Axenfeld-Rieger spectrum. One of these deletions was associated with hydrocephalus and is in keeping with previous reports.14
Large telomeric duplications were associated with a microcornea phenotype (individuals CE) in contrast to the iris hypoplasia phenotype, with the much smaller interstitial duplications (A and B), supporting a correlation between the phenotype and the extent of the cytogenetic abnormality. It also raises the intriguing possibility that the balance between the dose of gene, or genes, in the smaller (interstitial) and larger (telomeric) duplicated segments influences the dimensions of the ocular anterior segment. One candidate for such an interaction, known to be expressed in the eye, is the transcription factor gene TFAP2
, which lies within the region duplicated in individuals C through E.20
The identification of multiple interstitial cytogenetic abnormalities on 6p25 has interesting implications for the mechanisms underlying chromosomal rearrangements. These rearrangements are associated with a wide variety of genetic disorders and most frequently arise from homologous recombination between low-copy-number repetitive sequences. Interstitial duplications and deletions coexist in only a handful of disorders such as Charcot-Marie-Tooth disease (CMT/hereditary neuropathy with liability to pressure palsies [HNPP]), Smith Magenis syndrome (SMS), redgreen color blindness, thalassemia, and derivative 22 syndrome/velo-cardio-facial/DiGeorge syndrome.21 22 In two examples (CMT/HNPP and SMS) the flanking sequences responsible for these contiguous gene duplicationdeletion syndromes have been characterized.23 24 25 The demonstration of duplications in unrelated iris hypoplasia pedigrees led us to predict the existence of a similar mechanism, from which cases of other 6p25 cytogenetic abnormalities would be expected to arise. A panel of probands with anterior segment malformations was screened to test this hypothesis. The identification of a pedigree (J) with an interstitial deletion indicates that the 6p25 region is susceptible to chromosomal rearrangements.
Although the cause of these rearrangements is currently unknown, two mechanisms can be postulated. The first, homologous recombination and unequal crossing over, is dependent on the presence of significant regions of sequence homology.26 Although homologous sequence exists on 6p25, including the three forkhead genes (FOXC1, FOXF2, and FOXQ1), which share 70% to 75% sequence identity across their conserved forkhead domains, the variable extent of the duplication in these and other families5 argues against such a hypothesis. Alternatively, a novel, as yet unknown mechanism could be responsible, such as that which occurs in the rare X-linked condition, Pelizaeus-Merzbacher disease, in which duplications and deletions of differing size cause central nervous system (CNS) demyelination through altered dose of the proteolipid protein gene.27 28 Whatever the mechanism, it may be relevant to other areas of the genome, especially those containing forkhead gene clusters (e.g., 1p32, 12p13, 14q13, and 17q25). One such cluster, FOXC2/FOXF1/FOXL1, on 16q24 is relevant to ocular development, because it lies within the critical interval for a Rieger syndrome locus29 and haploinsufficiency of Foxc2 (and Foxc1) causes ocular anterior segment anomalies in mice.30 In view of the similarity to the 6p25 forkhead cluster (FOXC1/FOXF2/FOXQ1), it will be interesting to determine whether cytogenetic rearrangements underlie the 16q24-linked Axenfeld-Rieger phenotype.
The pedigrees with interstitial duplications and deletions reported in this article provide evidence for a common mechanism, causing cytogenetic rearrangements and a range of ocular developmental defects. The presence of 6p25 interstitial duplications and deletions represents the first example of both types of cytogenetic abnormalities causing a human developmental phenotype through presumed altered gene dosage of transcription factor. These findings add to the limited number of disorders in which pairs of interstitial duplications and deletions have been described and suggest that other cytogenetic abnormalities, such as inversions or hybrid genes, may be found in this region. It remains to be determined whether the pathogenicity of altered gene dosage, suggested with FOXC1 and previously demonstrated with PAX6,31 applies more generally to transcription factors.
| Appendix 1 |
|---|
|
|
|---|
Electronic Database Information and Accession Numbers
NIX is provided by the Medical Research Councils Human Genome Mapping Project Resources Centre (Cambridge, UK) and is available at http://www.hgmp.mrc.ac.uk/gdb-bin/.
Online Mendelian Inheritance in Man (OMIM), is provided by the National Center for Biotechnology Information, National Institutes of Health (Bethesda, MD) and is available at http://www.ncbi.nlm.nih.gov/omim/. Gene accession numbers: PITX2 (OMIM 601542), FOXC1 (601090), FOXC2 (602402), FOXF1 (601089), FOXF2 (603250), FOXL1 (603252), TFAP2
(107580), and GMDS (602884).
Chromosome 6 Project, Sanger Centre (Hinxton Hall, UK), available at http://www.sanger.ac.uk/HGP/Chr6/. Clone accession numbers: bA284J1 (AL392183), bA391F23 (AL356130), dJ856G1 (AL033381), dJ1077H22 (AL133402), bA550k21 (AL353618), dJ483L3 (AL035531), dJ116B8 (AL589989), bA13J16 (AL499606), dJ668J24 (AL034346), bA157J24 (AL512329), dJ118B18 (AL034344), bA265E5 (AL451141), dJ279I9 (AL033517), and bA82M9 (AL137179).
| Acknowledgements |
|---|
| Footnotes |
|---|
Submitted for publication September 26, 2001; revised January 11, 2002; accepted February 1, 2002.
Commercial relationships policy: N.
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C.
1734 solely to indicate this fact.
Corresponding author: Ordan J. Lehmann, Department of Molecular Genetics, Institute of Ophthalmology, Bath Street, London, UK EC1V 9EL; ojlehmann{at}yahoo.com.
| References |
|---|
|
|
|---|
that affects anterior eye chamber development J Med Genet 36,708-710This article has been cited by other articles:
![]() |
F. B. Berry, J. M. Skarie, F. Mirzayans, Y. Fortin, T. J. Hudson, V. Raymond, B. A. Link, and M. A. Walter FOXC1 is required for cell viability and resistance to oxidative stress in the eye through the transcriptional regulation of FOXO1A Hum. Mol. Genet., February 14, 2008; 17(4): 490 - 505. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Asai-Coakwell, C. Backhouse, R. J. Casey, P. J. Gage, and O. J. Lehmann Reduced Human and Murine Corneal Thickness in an Axenfeld-Rieger Syndrome Subtype Invest. Ophthalmol. Vis. Sci., November 1, 2006; 47(11): 4905 - 4909. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Weisschuh, P. Dressler, F. Schuettauf, C. Wolf, B. Wissinger, and E. Gramer Novel Mutations of FOXC1 and PITX2 in Patients with Axenfeld-Rieger Malformations. Invest. Ophthalmol. Vis. Sci., September 1, 2006; 47(9): 3846 - 3852. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. W. Hart, J. E. Morgan, J. Schneider, K. West, L. McKie, S. Bhattacharya, I. J. Jackson, and S. H. Cross Cardiac malformations and midline skeletal defects in mice lacking filamin A Hum. Mol. Genet., August 15, 2006; 15(16): 2457 - 2467. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. B. Berry, M. A. Lines, J. M. Oas, T. Footz, D. A. Underhill, P. J. Gage, and M. A. Walter Functional interactions between FOXC1 and PITX2 underlie the sensitivity to FOXC1 gene dose in Axenfeld-Rieger syndrome and anterior segment dysgenesis Hum. Mol. Genet., March 15, 2006; 15(6): 905 - 919. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. B. Berry, M. A. O'Neill, M. Coca-Prados, and M. A. Walter FOXC1 Transcriptional Regulatory Activity Is Impaired by PBX1 in a Filamin A-Mediated Manner Mol. Cell. Biol., February 15, 2005; 25(4): 1415 - 1424. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Lines, K. Kozlowski, S. C. Kulak, R. R. Allingham, E. Heon, R. Ritch, A. V. Levin, M. B. Shields, K. F. Damji, A. Newlin, et al. Characterization and Prevalence of PITX2 Microdeletions and Mutations in Axenfeld-Rieger Malformations Invest. Ophthalmol. Vis. Sci., March 1, 2004; 45(3): 828 - 833. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Saleem, T. C. Murphy, J. M. Liebmann, and M. A. Walter Identification and Analysis of a Novel Mutation in the FOXC1 Forkhead Domain Invest. Ophthalmol. Vis. Sci., November 1, 2003; 44(11): 4608 - 4612. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. J. Lehmann, S. Tuft, G. Brice, R. Smith, A. Blixt, R. Bell, B. Johansson, T. Jordan, R. A. Hitchings, P. T. Khaw, et al. Novel Anterior Segment Phenotypes Resulting from Forkhead Gene Alterations: Evidence for Cross-Species Conservation of Function Invest. Ophthalmol. Vis. Sci., June 1, 2003; 44(6): 2627 - 2633. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Walter PITs and FOXes in Ocular Genetics The Cogan Lecture Invest. Ophthalmol. Vis. Sci., April 1, 2003; 44(4): 1402 - 1405. [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |