IOVS Arteriosclerosis, Thrombosis, and Vascular Biology
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


(Investigative Ophthalmology and Visual Science. 2003;44:4601-4607.)
© 2003 by The Association for Research in Vision and Ophthalmology, Inc.
DOI:  10.1167/iovs.03-0582

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brandt, C. R.
Right arrow Articles by Kolb, A. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brandt, C. R.
Right arrow Articles by Kolb, A. W.

Tyrosine 116 of the Herpes Simplex Virus Type 1 IE{alpha}22 Protein Is an Ocular Virulence Determinant and Potential Phosphorylation Site

Curtis R. Brandt1,2 and Aaron W. Kolb1,3

1From the Departments of Ophthalmology and Visual Sciences, 2Medical Microbiology and Immunology, and 3Bacteriology, University of Wisconsin Medical School, Madison, Wisconsin.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
PURPOSE. To determine whether tyrosine 116 of the HSV-1 {alpha}22 protein is involved in virulence and is a potential phosphorylation site.

METHODS. Site-directed mutagenesis was used to revert the Y116C mutation in the {alpha}22 gene of the strain OD4 to wild type (C116Y), and the effect of virulence was tested by using a marker transfer–infection protocol in mice. Immunoblot analysis, tryptic phosphopeptide mapping, and phosphotyrosine pulldown–immunoblot protocols were used to assess the OD4 {alpha}22 isoforms.

RESULTS. Reversion of the Y116C mutation resulted in a significant increase in the severity of ocular disease compared with the OD4 virus alone. Reversion of the Y116C and a previously identified mutation (S34A) together did not alter the severity of virulence compared with either mutation alone. Immunoblot analysis revealed a loss or reduction in {alpha}22 isoforms in the OD4 virus compared with wild type (CJ394 virus). The OD4 virus had numerous alterations in the {alpha}22 tryptic phosphopeptide pattern, including loss of specific peptides and shifts in the position of several peptides. Phosphotyrosine pulldowns revealed a loss of one or more isoforms and shifts in the apparent size of others.

CONCLUSIONS. The data indicate that Y116 is a determinant of peripheral virulence in mice and that mutations at S34 and Y116 affect virulence independently. The data also show that the S34 and Y116 mutations substantially alter phosphorylation of the {alpha}22 protein, that Y116 is a potential phosphorylation site, and that the {alpha}22 protein contains at least two phosphotyrosines. These results are the first to show that mutation of a specific tyrosine in the {alpha}22 protein is associated with virulence.


Herpes simplex virus (HSV) is an major pathogen, infecting up to 90% of the population and causing mucocutaneous ulcers at many sites in the body. HSV is also the leading cause of sporadic viral encephalitis and blindness in developed countries.1 Despite the availability of several antivirals, HSV infections remain a serious problem.

Animal studies have clearly shown that the strain of virus plays an important role in determining disease severity, indicating that genes in the virus are critical. Although the HSV genome was sequenced in 1988,2 little is known about the functions of most HSV genes in the viral life cycle, and even less is known about the role of genes in virulence. Most studies have focused on the role of HSV genes in central nervous system (CNS) infection and several genes that function in encephalitis have been identified.3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Genes influencing peripheral disease are less well characterized, but some have been identified.4 5 21 22

Recently, we demonstrated that multiple genes can act in concert to determine the virulence phenotype of a given strain of HSV and that altering the combinations of genes could alter the disease.23 During these studies, we not only identified new HSV virulence genes, but also revealed several novel mutations in previously identified virulence genes. In particular, we found two mutations, S34A and Y116C, in the US1 gene of viral strain OD4, which encodes the immediate early {alpha}22 (IE{alpha}22) protein. Using site-directed mutagenesis, we reverted the mutation at position 34 to wild type and showed that this restores ocular virulence.23

The US1 gene contains an open reading frame of 420 amino acids that encodes a family of proteins that migrate with an apparent molecular mass ranging from 68 to 85 kDa.24 25 26 Deletion mutants without the US1 gene replicate in cultured cells,27 28 29 but display a host range phenotype, in that they replicate less well in certain cell types. These mutant viruses also have reduced capacity to establish latency, at least in mice.30 31 The {alpha}22 protein performs several functions, including regulating the expression of a subset of HSV-1 genes including ICP0, as well as certain ß and {gamma} genes.30 32 33 34 The {alpha}22 protein is also involved in regulating the phosphorylation state and localization of RNA polymerase II,35 36 37 and this function may be involved in the regulation of viral gene expression. The {alpha}22 protein has also been shown to bind to or affect the localization of other viral (UL3, UL4) and cellular proteins (p60, p78) within cells.38 39 40 41

The {alpha}22 protein is heavily posttranslationally modified, being tyrosine and serine phosphorylated, guanylated, and adenylated.26 32 42 43 44 45 At least seven isoforms of the {alpha}22 protein have been identified in infected cells.26 One important unknown concerning the {alpha}22 protein and its function is the location of the modifications. Mutation of a tyrosine kinase consensus site (Y193A) has been shown to alter the isoform pattern, but to date none of the posttranslational processing sites have been unambiguously identified. We do not know which isoforms have which modifications, nor which isoforms are responsible for performing the numerous functions ascribed to the {alpha}22 protein.

Given that the {alpha}22 protein is tyrosine phosphorylated, it was of interest to ask two questions regarding the Y116C mutation we had identified.23 First, is tyrosine 116 a virulence determinant, and, second, is tyrosine 116 a phosphorylation site in the protein? Using site-directed mutagenesis and marker transfer–infection assays, we showed in the current study that Y116 is involved in virulence and that the S34A and Y116C mutations in the strain OD4 US1 gene act independently to promote ocular virulence. We also showed that an {alpha}22 protein from strain OD4, carrying both the S34A and Y116C mutations, displays an altered phosphorylation pattern and, using phosphotyrosine pulldown assays, we showed that Y116C is a possible phosphorylation site in at least some of the {alpha}22 isoforms.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Cell Culture and Viruses
Vero cells were grown in Dulbecco’s modified Eagle’s medium (DMEM) containing 5% serum and antibiotics, as we described previously.46 High-titer stocks of the HSV-1 strains CJ394 and OD4 were prepared by infecting Vero cells at a low multiplicity of infection (MOI 0.1), as described elsewhere.46 The virulence properties of CJ394 and OD4 have been described.46 47 Briefly, CJ394 causes moderate keratitis after ocular infection and is not neurovirulent in mice aged 4 to 6 weeks or more. Strain OD4 is highly attenuated for peripheral and ocular virulence, carrying numerous attenuating mutations.23 The sequence of the CJ394 and OD4 US1 genes has been reported.23 Briefly, the CJ394 {alpha}22 gene has the same sequence as strain 17.2 Strain OD4 has four amino acid changes—S34A, D46E, D68E, and Y116C (Fig. 1) —in the region known to transfer virulence.23



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 1. Diagram of the HSV-1 genome showing the location of the {alpha}22 and US1.5 open reading frames and the relevant mutations in the OD4 {alpha}22 protein. Line A: schematic of the HSV-1 genome denoting the locations of the US1/1.5 gene in the unique short (US) region. Line B: US1.5 and {alpha}22 open reading frames. Line C: location and nature of the revertant mutations in the OD4 {alpha}22 protein and the corresponding wild-type amino acids in CJ394. TRL, terminal repeat long; UL, unique long region; IRL, internal repeat long; IRS, internal repeat short; TRS, terminal repeat short.

 
Site-Directed Mutagenesis of the OD4 US1 Gene
The reversion of the C116Y mutation was performed with two consecutive PCR reactions. In the first step, which introduced the desired change (C to Y), two primers, 5'-AAGCCACTCTGGTCCTCCGA-3' (forward) and 5'-GAGGGAATGTCATAAGACCAGTCG-3' (reverse), were used to generate a megaprimer. The first reaction consisted of 1x reaction buffer, 200 ng of the plasmid pOD4HE,23 300 ng of each primer, 100 µM of dNTPs (final concentration), 1% dimethyl sulfoxide (DMSO), and 2.5 units of pfu polymerase (Promega, Madison, WI) in a total volume of 100 µL. The cycling conditions were 1 cycle at 95°C for 5 minutes; 35 cycles of 95°C for 1 minute, 47°C for 1 minute, and 72°C for 17 seconds; and 1 cycle at 72°C for 7 minutes. After electrophoresis in a 1.5% agarose gel, the 145-bp megaprimer was isolated by gel extraction (QIAquick Gel Extraction Kit; Qiagen, Inc., Valencia, CA). The same reaction conditions were used in the second PCR step, except the megaprimer and the reverse (AAACAAGAAAGCTTGCACACG) primer were used. The cycling conditions were 1 cycle of 95°C for 5 minutes; 30 cycles of 95°C for 1 minute, 47°C for 2 minutes, and 72°C for 1 minute 43 seconds; and a final cycle at 72°C for 7 minutes. The product was gel purified and cloned into the pZErO-1 vector (Invitrogen, Carlsbad, CA). We also engineered the loss of a Tsp45I restriction site in the mutagenic primer to follow the mutation. The resultant C116Y clone was verified by sequencing at the University of Wisconsin-Madison Biotechnology Center, as we have described previously.23 The method for reversion of the S34A mutation has also been described.23

Marker Transfer of the C116Y Revertant US1 Gene
The gel-purified C116Y US1 gene fragment or a fragment containing reversions at both sites (34 and 116) was mixed with purified OD4 DNA48 and cotransfected into Vero cells using the modified calcium-phosphate method we described previously.23 Briefly, the ends of the US1 fragment were filled in with dideoxynucleotides, the CaPO4 precipitates were allowed to form for only 60 seconds at room temperature, the cells were split 1:1 12 to 18 hours before transfection, and finally the cells were trypsinized, mixed with the precipitates, and replated. The cells were shocked with 10% DMSO in HEPES buffer (140 mM NaCl, 5 mM KCl, 0.7 mM Na2HPO4, 6 mM glucose, 20 mM HEPES [pH 6.9]), rinsed twice with medium, and refed 4 to 6 hours after transfection. The next day, the medium was changed to 2% serum and incubated at 37°C. When the cultures reached 100% cytopathic effect (cpe), the cells were collected, centrifuged at 2000g for 10 minutes, resuspended in 250 µL of medium with 2% serum, and frozen and thawed three times. After centrifugation at 2000g for 10 minutes, the supernatants were stored at -80°C. The titers of the marker transfer stocks ranged from 1.0 x 108 to 5.0 x 108 plaque-forming units (pfu)/mL.

Animal Infection and Disease Scoring
Four- to six-week-old female BALB/c mice were infected as we have described.49 Briefly, the mice were anesthetized with halothane (3%–5%) and the corneas were scratched with a 30-gauge sterile needle. A 5-µL drop of each marker transfer stock (5 x 105 to 2.5 x 106 pfu) was then placed on the scarified cornea, and the mice were returned to their cages. Five independent transfections were tested for each gene with five mice in each of the five groups (25 mice in total). The severity of ocular disease was scored as we have described in several publications.23 46 47 50 51 52 We have shown that strain OD4 causes mild blepharitis, but no corneal neovascularization or stromal disease.46 Thus, for the mice to be scored positive for virulence, they had to have a minimum score of 1 for vascularization or 2 for stromal keratitis or had to die of encephalitis. The presence of blepharitis was used as a marker of infection, particularly in OD4-infected mice, but was not counted for virulence. For a mutation to be considered positive for virulence, a minimum of 20% of the mice had to score positive (P < 0.05) and at least two of the five independent transfections had to score positive.23 The use of animals in this study was approved by the University of Wisconsin Medical School IACUC and conforms to the guidelines of the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research.

Immunoblot Analysis
Vero cells were infected at an MOI of 5 in DMEM containing 2% serum. When the cytopathic effect reached 100% (24 hours after infection), the cells were harvested and centrifuged at 2000g for 10 minutes The medium was removed and the cells were resuspended in Laemmli buffer with 2-mercaptoethanol at a concentration of 8 x 107 cells/mL. The samples were sonicated at 30% duty cycle for 10 pulses with a cell disrupter (model 200; Branson Ultrasonics, Danbury, CT), boiled for 5 minutes, and centrifuged at 14,000g for 2 minutes. The supernatants were then electrophoresed in a 10% polyacrylamide gel53 for 18 hours at a 15-mA constant current. The samples were transferred electrophoretically to polyvinylidene difluoride (PVDF) membranes (Osmonics, Minnetonka, MN). The filters were then probed with a 1:2500 dilution of RGST22 antibody (kindly provided by John Blaho, Mount Sinai School of Medicine, New York, NY) for 1.5 hours. After they were washed, the filters were treated with a 1:2500 dilution of goat anti-rabbit horseradish peroxidase (HRP)–conjugated secondary antibody (Sigma-Aldrich; St. Louis, MO) for 1.5 hours. The filters were then washed and developed with a chemiluminescence detection kit (ECL; Amersham Biosciences, Piscataway, NJ) and exposed to x-ray film (Fuji Photograph Film, Ltd., Tokyo, Japan).

Two-Dimensional Phosphopeptide Assay
A confluent 10-cm plate of Vero cells was infected with either CJ394 or OD4 at an MOI of 10. At 50 minutes after attachment (1 hour 50 minutes after exposure to virus) 500 µCi of 32[P]-orthophosphate in phosphate-free DMEM-12% serum was added, and the labeling was allowed to proceed for 5 hours. The cells were then harvested and centrifuged at 2000g for 10 minutes. The cell pellet was resuspended in 300 µL of Laemmli buffer and processed as described for immunoblot analysis. The sample was electrophoresed in a 12% polyacrylamide gel for 18 hours at 15 mA and then electrophoretically transferred to nitrocellulose.

The filter was wrapped in plastic and exposed to x-ray film (Fuji) for 2 hours with the protein side toward the film. The band corresponding to the {alpha}22 protein was excised and placed into a microfuge tube with 200 µL of polyvinylpyrilidone solution (PVP 360,000, 0.5% vol/vol) and 100 mM acetic acid and then incubated with shaking for 30 minutes at 37°C. The gel slice was washed five times with deionized distilled (dd)H2O (1 mL each), and twice with 1 mL freshly prepared 50 mM NH4CO3 solution. Tryptic peptides were prepared by incubating the gel slice in 150 µL of a solution containing 100 µg sequencing grade trypsin (V511A; Promega) in 50 mM NH4CO3 for 5 hours at 37°C with shaking. The sample was mixed and centrifuged at 12,000g for 30 seconds, and the supernatant was transferred to a new tube. The gel slice was rinsed with 300 µL of water, and the supernatants were combined. The sample was then lyophilized and resuspended in 50 µL of ice-cold performic acid solution (98% performic acid [vol/vol], 10% H2O2 [vol/vol]), and the radioactivity measured in a scintillation counter (model LS5801; Beckman, Inc., Fullerton, CA). The samples were then applied to a cellulose thin-layer chromatography (TLC) plate (JT Baker, Inc., Phillipsburg, NJ) and electrophoresed with a commercial apparatus (Multiphore-II; Amersham Biosciences) for 25 minutes at 100 V, 50 mA, and 50 W. The TLC plates were rotated 90° and then subjected to TLC in n-butanol, pyridine, and acetic acid (15:10:12) for 5 hours. The plates were then exposed to x-ray film overnight.

Phosphotyrosine Pulldown Assays
Vero cells (2 x 107) were infected with either OD4 or CJ394 virus at an MOI of 10 and incubated for 8 hours at 37°C. The cells were rinsed once with PBS, 1 mL of lysis buffer (PBS with 1% NP-40 [vol/vol], 1% deoxycholate [wt/vol], 10 µM tolylsulfonylphenalanyl chloromethyl ketone, and 10 µM {alpha}-tosyl-L-lysine chloromethyl ketone) was added, and the plates were incubated at 4°C for 30 minutes. The lysate was scraped and transferred to a microcentrifuge tube sonicated at 30% duty cycle, 10 pulses, with the cell disrupter (model 200; Branson). The lysate was then centrifuged for 10 minutes at 10,000g at 4°C. The supernatant was transferred to a new tube and 10 µL of agarose beads coupled to anti-phosphotyrosine antibody (A-1806; Sigma-Aldrich) was added, and the lysate incubated with mixing for 1 hour at 4°C. The lysate was then centrifuged at 2000g for 5 minutes and rinsed with 1 mL of ice-cold PBS. The washes were repeated twice more and the pellet was resuspended in 50 µL of Laemmli buffer. After they were boiled for 5 minutes and centrifuged at 2000g for 5 minutes, the supernatants were electrophoresed in 10% SDS-PAGE gels as described earlier. After transfer to nitrocellulose, the filters were immunoblotted using {alpha}22 specific antiserum (RGST22), as described earlier.


    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Effect of Reversion of the Y116C Mutation on Ocular Virulence
To determine whether tyrosine 116 of the US1 gene was involved in virulence, we used site-directed mutagenesis to revert the Y116C mutation in the OD4 gene back to wild type (C116Y; Fig. 1 ). We then tested for restoration of virulence using a marker transfer–infection assay previously validated by us and others.23 54 As shown in Figure 2A , 40% of the mice showed significant ocular disease with the reverted mutation (C116Y) compared with none showing disease with the OD4 transfection alone. None of the infected mice died, suggesting that reversion of the Y116C mutation affects only peripheral disease. Figure 2B shows the mean peak disease scores (MPDSs) for OD4 and the revertant virus. Vascularization and stromal disease were restored to moderate levels only with the reverted US1 gene, and the increases in disease severity with the C116Y revertant were highly significant (Table 1) .



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 2. Reversion of the OD4 C116Y and A34S/C116Y together restores ocular virulence. Site-directed mutagenesis was used to specifically correct the OD4 116 mutation or both the 34 and 116 mutations and the effect on ocular disease was tested in a marker transfer–infection assay. (A) The percentage of mice showing evidence of increased disease severity (20% is P = 0.05). (B) The MPDSs for corneal neovascularization ({blacksquare}) and stromal keratitis ().

 

View this table:
[in this window]
[in a new window]
 
TABLE 1. Statistical Analysis of Mean Peak Disease Scores for Marker Transfer/Infections

 
The OD4 US1 gene also carries a mutation at position 34 (S34A), which we have shown is involved in peripheral virulence.23 Because reversion of either the S34A or Y116C mutations restored virulence separately, we asked how reversion of both mutations would affect disease. As shown in Figure 2 , reversion of both mutations together resulted in virulence that was indistinguishable from either mutation alone, with 40% of the mice showing that disease, stromal keratitis, and vascularization were restored to the same levels. The differences in the MPDSs between OD4 and the double reversion were highly significant (Table 1) . Mortality was also not increased. These results suggest that the two mutations independently affect peripheral virulence.

Altered {alpha}22 Isoform Pattern in Strain OD4
Because the {alpha}22 protein is known to be phosphorylated on both serine and tyrosine residues and because we have identified virulence-related serine and tyrosine mutations in strain OD4, it was of interest to see whether the OD4 {alpha}22 protein displays an altered isoform pattern. Strain CJ394, which causes moderate ocular disease and in which the US1 gene has the wild-type sequence at positions 34 and 116, was used as the control. Vero cells were infected with each virus, and cell extracts were analyzed by immunoblot. To optimize visualization of the various isoforms, the samples were serially diluted twofold before electrophoresis. As shown in Figure 3 , several isoforms were seen in the CJ394 sample with what are two clusters of proteins migrating with apparent molecular masses of 85 kDa (open arrows) and 75 kDa (closed arrows) and a single form at 68 kDa (small arrow, CJ394, lane 1). Because the samples were serially diluted, the 68-kDa band was lost first in the OD4-infected cells, followed by the cluster at 85 kDa, suggesting these isoforms were present at lower levels in infected cells. In the OD4 samples, the isoforms at 68 and 85 kDa in the undiluted samples were either absent or present in much smaller amounts than in the CJ394 sample. Because the OD4 sample was diluted, only the 75-kDa isoforms were seen. In addition, it also appeared that the number of the 75-kDa forms was increased in the OD4-infected cells (Fig. 3 , compare lanes 3 and 7). These results suggested that posttranslational processing of the OD4 {alpha}22 protein was altered.



View larger version (54K):
[in this window]
[in a new window]
 
FIGURE 3. Immunoblot analysis of {alpha}22 protein isoforms in CJ394- and OD4-infected Vero cells. Vero cells were infected at an MOI of 5, and at 24 hours after infection the cells were harvested and lysed in Laemmli buffer. The samples were then serially diluted twofold (lanes 1-4), electrophoresed in a 10% denaturing polyacrylamide gel, and immunoblotted with RGST22 antibody. Extracts from equal numbers of cells were loaded in the comparable lanes 1 to 4 in the CJ394 and lanes 5 to 8 in the OD4 samples. Large open arrows: cluster of isoforms at 85 kDa. Large filled arrowheads: isoforms at 75 kDa; smaller filled arrows: 68-kDa isoform.

 
To confirm that phosphorylation of {alpha}22 was altered in OD4, we performed a two-dimensional tryptic phosphopeptide mapping analysis. The data in Figure 4A show that at least 17 tryptic phosphopeptides were present in the CJ394 {alpha}22 sample. Analysis of the OD4 pattern (Fig. 4B) showed that overall, the number of peptides was much reduced, that numerous tryptic phosphopeptides were missing, and that others had shifted position. To highlight the differences, the OD4 and CJ394 data were colorized and then the images were merged (Fig. 4C) . Several peptides that differ between the two viruses are marked in Figure 4C . Note, in particular, peptides marked 394-2b and 394-5 in the CJ394 protein, which are missing in the OD4 {alpha}22 protein. Also tryptic peptides OD4-2b and OD4-4 occupy positions similar to those of peptides 394-7 and 394-10; however, the OD4 peptides are shifted toward the anode to a lesser degree. In addition, peptide intensity also changes. For example, peptide 7-394 shows greater intensity than the similar peptide OD4-2b. These results confirm the immunoblot analysis data indicating that posttranslational processing of the OD4 {alpha}22 protein is substantially altered.



View larger version (46K):
[in this window]
[in a new window]
 
FIGURE 4. Tryptic phosphopeptide mapping of {alpha}22 proteins. Infected cells were labeled with 32[P]-orthophosphate from 1 hour 50 minutes to 5 hours after virus was added and harvested, and the proteins were electrophoresed in a 12% denaturing polyacrylamide gel. After exposure to x-ray film, the region containing the {alpha}22 protein was removed and digested with trypsin, and the resultant radiolabeled peptides were analyzed by two-dimensional electrophoresis/TLC. (A) CJ394 {alpha}22 protein. The peptides were given increasing numbers from top to bottom. Peptides were labeled with lowercase letters moving from left to right. (B) OD4 {alpha}22 peptides numbered as in (A). (C) shows the merged image and several peptides that differed between the two samples are labeled with the corresponding numbers from (A) and (B).

 
A Potential Phosphorylation Site
We next wanted to determine whether either S34 or Y116 was a possible phosphorylation site. Reasoning that if either residue were phosphorylated, the isoforms without S34 or Y116 would not be precipitated, we used agarose-coupled monoclonal antibodies to either phosphoserine or phosphotyrosine in pulldown assays. To date, we have been unable to pull down the serine-phosphorylated {alpha}22 protein. However, Figure 5 shows the results from the phosphotyrosine pulldown–{alpha}22 immunoblot analyses. At least one isoform migrating at 85 kDa in CJ394-infected cells was clearly absent in the OD4 samples. In addition, the material at 75 kDa, which is composed of a doublet, appeared to have shifted in the OD4 samples to a lower apparent size, as would be expected if these isoforms lost one or more phosphate groups. The loss of the 85-kDa isoform indicates that in this isoform, tyrosine phosphorylation occurs only at position 116 in strain CJ394. A faint band migrating at 68 kDa, which is difficult to see in Figure 5 , was also seen in the CJ394 and OD4 phosphotyrosine pulldown assays, suggesting a small amount of this isoform may be tyrosine phosphorylated.



View larger version (32K):
[in this window]
[in a new window]
 
FIGURE 5. Phosphotyrosine pulldown immunoblot analysis of {alpha}22 proteins. Infected cells were lysed and incubated with agarose coupled anti-phosphotyrosine antibody. After extensive washing, the proteins were electrophoresed and blotted with the {alpha}22-specific RGST22 antibody. The top band in the CJ394 sample migrated as a doublet of 85 kDa, with the top band being much more intense. The second band in the CJ394 lane is actually a doublet migrating at approximately 75 kDa. Note that this doublet is visible in the OD4 lane, but migrates slightly faster, suggesting the loss of at least one phosphate group.

 

    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
The HSV-1 {alpha}22 protein has been shown to be a host range determinant, because deletion of the entire gene31 or the carboxyl terminus30 reduces the capacity of the mutant viruses to cause disease in animal models, alters the latency phenotype of the mutant viruses, results in growth defects in certain cell lines, and reduces viral replication in vivo. Recently, we demonstrated that the virulence phenotype of HSV-1 was dependent on the functioning of multiple genes.23 One of the genes we identified as being required for peripheral virulence (keratitis) was the US1 gene encoding the {alpha}22 protein. We also reported that S34 of the {alpha}22 protein was required for virulence and noted the presence of a second mutation, Y116C, in the same protein.23 In the present work, we show that the tyrosine at position 116 is also required for ocular virulence.

We previously showed that reversion of the S34A mutation restores virulence.23 Our observation that reversion of the Y116C mutation also restored virulence led us to ask whether S34 and Y116 had any effect on each other. We found that reverting both mutations to wild type in the same construct resulted in virulence scores identical with those obtained with either mutation alone, suggesting that S34 and Y116 apparently have independent functions in virulence. This observation has important implications for the studies on the genetics of viral virulence. Considering that both mutations are involved in virulence, if either residue in the wild-type protein had been mutated alone, we would have failed to see any effect. These results demonstrate the value of gain-of-function studies for the identification of virulence factors. Presently, we do not know whether S34 and Y116, independently, affect a similar step or whether two independent virulence functions are affected.

Our data also indicate that posttranslational processing of the OD4 {alpha}22 protein is substantially altered based on the changes in the isoform pattern (Fig. 3) , the significant differences in the tryptic phosphopeptide patterns between CJ394 and OD4 viruses (Fig. 4) , and the differences in results of the pulldown experiments (Fig. 5) . Because it has been shown that multiple mutations in widely dispersed sites in the {alpha}22 protein can affect posttranslational processing,44 we cannot as yet ascribe the altered processing to any single mutation. The OD4 US1 gene also contains two conservative mutations, D46E and D68E; however, because these changes were present in all the constructs we tested, they would not affect the interpretation of our data.

We found that at least one isoform migrating with an apparent size of 85 kDa was missing in the OD4 phosphotyrosine pulldown study, indicating that this isoform has a single phosphotyrosine modification that is lost in the OD4 protein. The observation that additional isoforms were seen in the OD4 phosphotyrosine pulldown studies shows that some isoforms must contain at least two phosphotyrosines. O’Toole et al.26 have recently shown that mutation of tyrosine 193 alters the processing patterns of the {alpha}22 protein, and this may be the second tyrosine phosphorylation site.

Two possible explanations exist for the altered posttranslational processing of the OD4 {alpha}22 protein with respect to tyrosine phosphorylation. The Y116C mutation in the OD4 protein could alter the ability of tyrosine kinases to modify the protein, or the Y116C mutation could remove a phosphorylation site. A comparison of the relative amounts of the {alpha}22 protein in OD4- and CJ394-infected cells (Fig. 3) shows that the total amount of protein is essentially equal. Data from the phosphotyrosine pulldown assays showed that the OD4 protein is tyrosine phosphorylated in at least one additional site, suggesting that any potential conformational change is not severe enough to affect tyrosine phosphorylation at this site.

Our analysis of isoform patterns was performed at several times after infection, ranging from 8 hours to as late as 24 hours. Although the {alpha}22 gene is classified as an immediate early gene,29 the function of {alpha}22 is required for efficient expression of a subset of late genes32 ; thus, the protein functions throughout the life cycle and analysis of isoforms at late times is warranted. It will be interesting to analyze the kinetics of processing the {alpha}22 protein at various times after infection, once viruses containing only the S34A and Y116C mutations are available. The role of {alpha}22 in function is also dependent on the cell type,30 and it will be of interest to analyze {alpha}22 processing in various cells with appropriate mutant viruses.

Some of the modifications to the {alpha}22 protein depend on the UL13 kinase and to a lesser extent on the US3 kinase,32 55 and deletion of the UL13 kinase gene generates a virus with a phenotype very similar, if not identical, to a US1 deletion,32 raising the possibility that mutations in the OD4 UL13 or US3 genes could affect virulence through altered phosphorylation of the {alpha}22 protein. A previous genome screen of OD4 virulence mutations23 showed that the CJ394 UL13 and US3 genes were not involved in transfer of virulence to the OD4 virus. Moreover, the reversion of the Y116C mutation in the OD4 {alpha}22 protein restored ocular virulence, localizing the effect to the {alpha}22 protein itself.

In 1996, Carter and Roizman identified a gene (denoted US1.5) that overlaps the US1 gene.56 This second gene encodes a protein containing the carboxyl terminal 273 residues of the {alpha}22 protein. This does not affect our findings, because both S34 and Y116 are contained only in the portion encoding the {alpha}22 protein.

In summary, we have shown that tyrosine 116 of the HSV-1 {alpha}22 protein is required for peripheral virulence. In addition, alterations in virulence may be associated with altered tyrosine phosphorylation of the {alpha}22 protein. The data also suggest that at least two tyrosine phosphorylation sites exist in the protein and that Y116C may be one of these sites. Further studies of the role of tyrosine 116 of the {alpha}22 protein will provide critical information on the role of this residue on the biology of the virus and the impact of tyrosine phosphorylation on viral virulence.


    Acknowledgements
 
The authors thank Inna Larsen for administrative assistance, and members of the laboratory for helpful suggestions concerning the studies and comments on the manuscript.


    Footnotes
 
Supported by National Eye Institute Grant EY07336 (CRB) and an unrestricted grant to the Department of Ophthalmology and Visual Sciences from Research to Prevent Blindness, Inc.

Submitted for publication June 10, 2003; revised July 15, 2003; accepted July 17, 2003.

Disclosure: C.R. Brandt, None; A.W. Kolb, None

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: Curtis R. Brandt, Department of Ophthalmology and Visual Sciences, University of Wisconsin, 6630 Medical Sciences Center, 1300 University Avenue, Madison, WI 53706; crbrandt{at}facstaff.wisc.edu.


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Whitley, RJ. (1996) Herpes simplex viruses Fields, BN Knipe, DM Howley, PM eds. 3rd ed. Fields Virology 2,2297-2342 Lippincott-Raven Philadelphia.
  2. McGeoch, DJ, Dalyrymple, MA, Davison, AJ, et al (1988) The complete DNA sequence of the long unique region in the genome of herpes simplex virus type 1 J Gen Virol 69,1531-1574[Abstract/Free Full Text]
  3. Visalli, RJ, Brandt, CR. (2002) Mutation of the herpes simplex virus-1 KOS UL45 gene reveals dose dependent effects on central nervous system growth Arch Virol 147,519-532[CrossRef][Medline][Order article via Infotrieve]
  4. Idowu, AD, Fraser-Smith, EB, Poffenberger, KL, Herman, RC. (1992) Deletion of the herpes simplex virus type 1 ribonucleotide reductase gene alters virulence and latency in vivo Antiviral Res 17,145-156[Medline][Order article via Infotrieve]
  5. Yamada, Y, Kimura, H, Morishima, T, et al (1991) The pathogenicity of ribonucleotide reductase (RR)-null mutants of herpes simplex virus type 1 in mice J Infect Dis 164,1091-1097[Medline][Order article via Infotrieve]
  6. Nash, TC, Spivack, JG. (1994) The UL55 and UL56 genes of herpes simplex virus type 1 are not required for viral replication, intraperitoneal virulence, or establishment of latency in mice Virology 204,794-798[CrossRef][Medline][Order article via Infotrieve]
  7. Weise, K, Kaerner, HC, Glorioso, J, Schröder, CH. (1987) Replacement of glycoprotein B gene sequences in herpes simplex virus type 1 strain ANG by corresponding sequences of the strain KOS causes changes of plaque morphology and neuropathogenicity J Gen Virol 68,1909-1919[Abstract/Free Full Text]
  8. Javier, RT, Sedarati, F, Stevens, JG. (1986) Two avirulent herpes simplex viruses generate lethal recombinants in vivo Science 234,746-748[Abstract/Free Full Text]
  9. Sedarati, F, Javier, RT, Stevens, JG. (1988) Pathogenesis of a lethal mixed infection in mice with two nonneuroinvasive herpes simplex virus strains J Virol 62,3037-3039[Abstract/Free Full Text]
  10. Sedarati, F, Stevens, JG. (1987) Biological basis for virulence of three strains of herpes simplex virus type 1 J Gen Virol 68,2389-2395[Abstract/Free Full Text]
  11. Yuhasz, SA, Stevens, JG. (1993) Glycoprotein B is a specific determinant of herpes simplex virus type 1 neuroinvasiveness J Virol 67,5948-5954[Abstract/Free Full Text]
  12. Tran RK, Lieu, PT, Aguilar S, Wagner, EK, Bloom, DC. (2002) Altering the expression kinetics of VP5 results in altered virulence and pathogenesis of herpes simples virus type 1 in mice J Virol 76,2199-2205[Abstract/Free Full Text]
  13. Izumi, KM, Stevens, JG. (1990) Molecular and biological characterization of a herpes simplex virus type 1 (HSV-1) neuroinvasiveness gene J Exp Med 172,487-496[Abstract/Free Full Text]
  14. Perng, G-C, Esmaili, D, Slanina, SM, et al (2001) Three herpes simplex virus type 1 latency-associated transcript mutants with distinct and asymmetric effects on virulence in mice compared with rabbits J Virol 75,9018-9028[Abstract/Free Full Text]
  15. Ben-Hur, T, Rosen-Wölff, A, Lamade, W, Darai, G, Becker, Y. (1988) HSV-1 DNA sequence determining intraperitoneal pathogenicity in mice is required for transcription of viral immediate-early genes in macrophages Virology 163,397-404[CrossRef][Medline][Order article via Infotrieve]
  16. Chou, J, Kern, ER, Whitley, RJ, Roizman, B. (1990) Mapping of herpes simplex virus-I neurovirulence to {gamma}1–34.5, a gene nonessential for growth in culture Science 250,1262-1265[Abstract/Free Full Text]
  17. Cameron, JM, McDougall, I, Marsden, HS, et al (1988) Ribonucleotide reductase encoded by Herpes simplex virus is a determinant of pathogenicity of the virus in mice and a valid antiviral target J Gen Virol 69,2607-2612[Abstract/Free Full Text]
  18. Efstathiou, S, Kemp, S, Darby, G, Minson, AC. (1989) The role of herpes simplex virus type 1 thymidine kinase in pathogenesis J Gen Virol 70,869-879[Abstract/Free Full Text]
  19. Meignier, B, Longnecker, R, Mavromara-Nazos, P, Sears, AE, Roizman, B. (1988) Virulence of and establishment of latency by genetically engineered deletion mutants of herpes simplex virus 1 Virology 162,251-254[CrossRef][Medline][Order article via Infotrieve]
  20. Taha, MY, Clements, GE, Brown, SM. (1989) The herpes simplex virus type 2 (HG52) variant JH2604 has a 1488 bp deletion which eliminates neurovirulence in mice J Gen Virol 70,3073-3078[Abstract/Free Full Text]
  21. Strelow, LI, Leib, DA. (1996) Analysis of conserved domains of UL41 of herpes simplex virus type 1 in virion host shutoff and pathogenesis J Virol 70,5665-5667[Abstract/Free Full Text]
  22. Brandt, CR. (1991) Mixed ocular infections identify strains of herpes simplex virus for use in genetic studies J Virol Methods 35,127-135[CrossRef][Medline][Order article via Infotrieve]
  23. Brandt, CR, Kolb, AW, Shah, DD, et al (2003) Multiple determinants contribute to the virulence of HSV ocular and CNS infection and identification of serine 34 of the US1 gene as an ocular disease determinant Invest Ophthalmol Vis Sci 44,2657-2668[Abstract/Free Full Text]
  24. Ackermann, M, Sarmiento, M, Roizman, B. (1985) Application of antibody to synthetic peptides for characterization of the intact and truncated {alpha}22 protein specified by herpes simplex virus 1 and the R325 {alpha}22-deletion mutant J Virol 56,207-215[Abstract/Free Full Text]
  25. Marsden, HS, Stow, ND, Preston, VG, Timbury, MC, Wilkie, NM. (1978) Physical mapping of herpes simplex virus-induced polypeptides J Virol 28,624-642[Abstract/Free Full Text]
  26. O’Toole, JM, Aubert, M, Kotsakis, A, Blaho, JA. (2003) Mutation of the protein tyrosine kinase consensus site in the herpes simplex virus 1 {alpha}22 gene alters ICP22 posttranslational modification Virology 305,153-167[CrossRef][Medline][Order article via Infotrieve]
  27. Ogle, WO, Roizman, B. (1999) Functional anatomy of herpes simplex virus 1 overlapping genes encoding infected-cell protein 22 and US1.5 protein J Virol 73,4305-4315[Abstract/Free Full Text]
  28. Poffenberger, KL, Raichlen, PE, Herman, RC. (1993) In vitro characterization of a herpes simplex virus type 1 ICP22 deletion mutant Virus Genes 7,171-186[CrossRef][Medline][Order article via Infotrieve]
  29. Post, LE, Roizman, B. (1981) A generalized technique for deletion of specific genes in large genomes: {alpha} gene 22 of herpes simplex virus 1 is not essential for growth Cell 25,227-232[CrossRef][Medline][Order article via Infotrieve]
  30. Sears, AE, Halliburton, IW, Meignier, B, Silver, S, Roizman, B. (1985) Herpes simplex virus 1 mutant deleted in the {alpha}22 gene: growth and gene expression in permissive and restrictive cells and establishment of latency in mice J Virol 55,338-346[Abstract/Free Full Text]
  31. Poffenberger, KL, Idowu, AD, Fraser-Smith, EB, Raichlen, PE, Herman, RC. (1994) A herpes simplex virus type 1 ICP22 deletion mutant is altered for virulence and latency in vivo Arch Virol 139,111-119[CrossRef][Medline][Order article via Infotrieve]
  32. Purves, FC, Ogle, WO, Roizman, B. (1993) Processing of the herpes simplex virus regulatory protein {alpha}22 mediated by the UL13 protein kinase determines the accumulation of a subset of {alpha} and {gamma} mRNAs and proteins in infected cells Proc Natl Acad Sci USA 90,6701-6705[Abstract/Free Full Text]
  33. Prod’hon, C, Machuca, I, Berthomme, H, Epstein, A, Jacquemont, B. (1996) Characterization of regulatory function of the HSV-1 immediate-early protein ICP22 Virology 226,393-402[CrossRef][Medline][Order article via Infotrieve]
  34. Ng, TI, Chang, YE, Roizman, B. (1997) Infected cell protein 22 of herpes simplex virus 1 regulates the expression of virion host shutoff gene UL41 Virology 234,226-234[CrossRef][Medline][Order article via Infotrieve]
  35. Rice, SA, Long, MC, Lam, V, Spencer, CA. (1994) RNA polymerase II is aberrantly phosphorylated and localized to viral replication compartments following herpes simplex virus infection J Virol 68,988-1001[Abstract/Free Full Text]
  36. Rice, SA, Long, MC, Lam, V, Schaffer, PA, Spencer, CA. (1995) Herpes simplex virus immediate-early protein ICP22 is required for viral modification of host RNA polymerase II and establishment of the normal viral transcription program J Virol 69,5550-5559[Abstract]
  37. Jenkins, FJ, Spencer, CA. (2001) RNA polymerase II holoenzyme modifications accompany transcription reprogramming in herpes simplex virus type 1-infected cells J Virol 75,9872-9884[Abstract/Free Full Text]
  38. Bruni, R, Fineschi, B, Ogle, WO, Roizman, B. (1999) A novel cellular protein, p60, interacting with both herpes simplex virus 1 regulatory proteins ICP22 and ICP0 is modified in a cell-type specific manner and is recruited to the nucleus after infection J Virol 73,3810-3817[Abstract/Free Full Text]
  39. Bruni, R, Roizman, B. (1998) Herpes simplex virus 1 regulatory protein ICP22 interacts with a new cell cycle-regulated factor and accumulates in a cell cycle-dependent fashion in infected cells J Virol 72,8525-8531[Abstract/Free Full Text]
  40. Leopardi, R, Ward, PL, Ogle, WO, Roizman, B. (1997) Association of herpes simplex virus regulatory protein ICP22 with transcriptional complexes containing EAP, ICP4, RNA polymerase II, and viral DNA requires posttranslational modification by the UL13 protein kinase J Virol 71,1133-1139[Abstract]
  41. Markovitz, NS, Roizman, B. (2000) Small dense nuclear bodies are the site of localization of herpes simplex virus 1 UL3 and UL4 proteins and of ICP22 only when the latter protein is present J Virol 74,523-528[Abstract/Free Full Text]
  42. Mitchell, C, Blaho, JA, Roizman, B. (1994) Casein kinase II specifically nucleotidylylates in vitro the amino acid sequence of the protein encoded by the {alpha}22 gene of herpes simplex virus 1 Proc Natl Acad Sci USA 91,11864-11868[Abstract/Free Full Text]
  43. Mitchell, C, Blaho, JA, McCormick, AL, Roizman, B. (1997) The nucleotidylation of herpes simplex virus 1 regulatory protein {alpha}22 by human casein kinase II J Biol Chem 272,25394-25400[Abstract/Free Full Text]
  44. Poon, APW, Ogle, WO, Roizman, B. (2000) Posttranslational processing of infected cell protein 22 mediated by viral protein kinases is sensitive to amino acid substitutions at distant sites and can be cell-type specific J Virol 74,11210-11214[Abstract/Free Full Text]
  45. Blaho, JA, Zong, C, Mortimer, KA. (1997) Tyrosine phosphorylation of the herpes simplex virus type 1 regulatory protein ICP22 and a cellular protein which shares antigenic determinants with ICP22 J Virol 71,9828-9832[Abstract]
  46. Grau, DR, Visalli, RJ, Brandt, CR. (1989) Herpes simplex virus stromal keratitis is not titer-dependent and does not correlate with neurovirulence Invest Ophthalmol Vis Sci 30,2474-2480[Abstract/Free Full Text]
  47. Brandt, CR, Grau, DR. (1990) Mixed infection with herpes simplex virus type 1 generates recombinants with increased ocular and neurovirulence Invest Ophthalmol Vis Sci 31,2214-2223[Abstract/Free Full Text]
  48. Kintner, RL, Brandt, CR. (1994) Rapid small-scale isolation of herpes simplex virus DNA J Virol Methods 48,189-196[CrossRef][Medline][Order article via Infotrieve]
  49. Brandt, CR, Coakley, LM, Grau, DR. (1992) A murine model of herpes simplex virus-induced ocular disease for antiviral drug testing J Virol Methods 36,209-222[CrossRef][Medline][Order article via Infotrieve]
  50. Brandt, CR, Kintner, RL, Visalli, RJ, Pumfery, AM. (1994) Ribonucleotide reductase and the ocular virulence of HSV-1 Becher, Y Darai, G eds. Frontiers in Virology: Pathogenicity of Human Herpesviruses Due to Specific Pathogenicity Genes 3,137-150 Springer-Verlag New York.
  51. Kintner, RL, Allan, RW, Brandt, CR. (1995) Recombinants are isolated at high frequency following in vivo mixed ocular infection with two avirulent herpes simplex virus type 1 strains Arch Virol 140,231-244[CrossRef][Medline][Order article via Infotrieve]
  52. Kintner, RL, Brandt, CR. (1995) The effect of viral inoculum level and host age on disease incidence, disease severity, and mortality in a murine model of ocular HSV-1 infection Curr Eye Res 14,145-152[Medline][Order article via Infotrieve]
  53. Visalli, RJ, Brandt, CR. (1993) The HSV-1 UL45 18 kDa gene product is a true late protein and a component of the virion Virus Res 29,167-178[CrossRef][Medline][Order article via Infotrieve]
  54. Thompson, RL, Devi-Rao, G, Stevens, JG, Wagner, EK. (1993) Physical location of a herpes simplex virus gene function(s) specifically associated with 10-million-fold increase in HSV neurovirulence Virology 131,180-192
  55. Purves, FC, Roizman, B. (1992) The UL13 gene of herpes simplex virus 1 encodes the functions for posttranslational processing associated with phosphorylation of the regulatory protein {alpha}22 Proc Natl Acad Sci USA 89,7310-7314[Abstract/Free Full Text]
  56. Carter, KL, Roizman, B. (1996) The promoter and transcriptional unit of a novel herpes simplex virus 1 {alpha} gene are contained in, and encode a protein in frame with, the open reading frame of the {alpha}22 gene J Virol 70,172-178[Abstract]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brandt, C. R.
Right arrow Articles by Kolb, A. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Brandt, C. R.
Right arrow Articles by Kolb, A. W.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS