IOVS
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


(Investigative Ophthalmology and Visual Science. 2004;45:385-392.)
© 2004 by The Association for Research in Vision and Ophthalmology, Inc.
DOI:  10.1167/iovs.03-0968

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (10)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chauhan, B. K.
Right arrow Articles by Cvekl, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chauhan, B. K.
Right arrow Articles by Cvekl, A.

Functional Properties of Natural Human PAX6 and PAX6(5a) Mutants

Bharesh K. Chauhan, Ying Yang, Kveta Cveklová, and Ales Cvekl

From the Departments of Ophthalmology and Visual Sciences and Molecular Genetics, Albert Einstein College of Medicine, Bronx, New York.


    Abstract
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
PURPOSE. Pax6 is essential for development of the eye, brain, and pancreas. Two major products of PAX6 are specific DNA-binding proteins, PAX6 and PAX6(5a). PAX6(5a) contains a short insertion influencing its DNA-binding activity. Heterozygous mutations in PAX6 result in abnormal eye development implicating haploinsufficiency. Deletions of one PAX6 allele result in aniridia characterized by severe ocular phenotypes. Approximately 10% of PAX6 mutations encode missense mutations. These mutations usually cause less severe abnormalities than does aniridia. The moderate phenotypes raise the possibility that different ocular tissues are differently sensitive to specific mutations. To test this hypothesis, we probed functional properties of individual mutated Pax6 proteins in a variety of conditions.

METHODS. Mutations in PAX6 and PAX6(5a) were introduced by site-directed mutagenesis and tested by transfections in four cell lines using reporters containing three different Pax6 binding sites. Pax6 binding to DNA was studied by electrophoretic mobility shift assays.

RESULTS. Functional studies of PAX6 and PAX6(5a) and their eight natural missense (G18W, R26G, A33P, S43P, G64V, I87R, V126D and R128C) and two nonsense (R317X and S353X) disease-causing mutants revealed unexpected pleiotropic effects in gene regulation, not predicted by the PAX6-DNA crystal structure. Transactivation by PAX6 and PAX6(5a) was dependent on the location of mutation, type of DNA-binding site, and cellular environment.

CONCLUSIONS. This work provides evidence that activation by PAX6 and PAX6(5a) is modulated by specific cellular environments. It is likely that moderate phenotypes associated with PAX6 missense mutations originate from abnormal protein function in a restricted number of ocular cell types.


Pax6 is a highly conserved member of a Pax family of genes encoding transcription factors.1 Nine mammalian Pax genes (Pax1 to Pax9) share an N-terminal 128 amino acid DNA-binding domain called the paired domain (PD). The PD of Pax proteins can be structurally and functionally separated into two independent DNA-binding subdomains, PAI and RED.2 Pax6 also contains an internal, paired-type homeodomain (HD), allowing different modes of Pax6 binding to DNA. Mammalian Pax6 genes encode predominantly two forms of the Pax6 protein, Pax6 and Pax6(5a).3 4 5 Pax6 contains a canonical PD. In contrast, Pax6(5a) contains a 14 amino acid insertion within the PAI domain (see Fig. 1A ). Pax6 plays critical roles in the organogenesis of the brain, visual, and olfactory systems, as well as peptide hormone gene expression in the pancreas.6 7 8 9 10 Numerous studies have shown that Pax6 is essential for morphogenesis of the eye from its earliest stages and subsequent formation of all major ocular tissues.7 11 12



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 1. Structure of PAX6 and PAX6(5a) and position of human mutations. (A) Schematic representation of PAX6 (amino acid residues 1-422); PAX6(5a) (amino acid residues 1-436); PAX6 PD, HD (yellow); and transcriptional activation domain (P/S/T, green); and subdivision of PD into the PAI (blue) and RED (red) subdomains. Oligopeptide of 14 amino acid residues (light blue) encoded by exon 5a disrupts DNA-binding property of the PD. (B) Schematic representation of secondary structures ({alpha}-helices and ß-turns) in PD. The DNA-recognition structures are ß-turn motifs, ß1 and ß2, recognizing the minor groove of DNA, and two {alpha}-helices, {alpha}3 and {alpha}6, recognizing the major groove of DNA. Mutations are shown in circles, and the major characteristics of the human phenotype of specific mutations are displayed. (C) Schematic representation of two truncated PAX6 proteins encoded by R317X and S353X. Mutants of PAX6(5a) have a similar structure (not shown). The references for mutations are: G18W,17 R26G,15 A33P, S43P, G64V and V126D,18 I87R,37 R128C,27 R317X,18 and S353X.14 For additional information, see Table 1 . AN, Aniridia; pAN, partial aniridia; CAT, cataract; FOV, foveal hypoplasia; and PET, Peters’ anomaly.

 
In humans, heterozygous mutations in PAX6 cause a wide spectrum of ocular defects13 14 15 16 17 18 19 20 21 22 and subtle changes in the olfactory epithelium and brain.23 Mutations generating truncated PAX6 proteins and deletions of one allele typically result in aniridia. The prominent feature of aniridia is iris hypoplasia, often combined with cataracts, glaucoma, nystagmus, and foveal and optic nerve hypoplasia.24 25 Missense mutations generating single amino acid substitutions, representing approximately 10% of total mutations, cause less severe abnormalities (e.g., foveal hypoplasia, Peters’ anomaly, congenital cataracts, and autosomal dominant keratitis).10 26 A rare case of a human PAX6 compound homozygote resulted in anophthalmia and lethal brain defects.14 Hence, it has been proposed that a PAX6 gene dosage effect is responsible for phenotypes associated with mutations in one or both alleles of PAX6.8 10

Molecular studies of natural PAX6 mutants are useful in understanding the molecular mechanisms of PAX6 and other PAX proteins; however, earlier studies have focused only on a single or a few mutants tested in a single common cell line. Notably, two missense mutations, R26G and R128C, tested in P19 cells, reduced PAX6- but increased PAX6(5a)-activation potential, suggesting that a specific mutant can act as a hypermorph.27 Crystal structure of Pax6 PD in complex with DNA provides a model to understand the function of individual structural motifs comprising the PD and may ultimately predict impact of disease-causing single amino acid substitutions.28

In this report, we sought to determine transactivation and DNA-binding properties of 10 representative natural PAX6 and PAX6(5a) mutants with different reporters using a variety of DNA-binding mechanisms in different cell types. The results revealed an unexpected range of reduced or increased transactivation properties of each mutant tested. Our data indicate that cellular environment might influence whether an individual mutation acts as loss- or gain-of-function or neutrally. The results also suggest that some mutations not only impair the respective subdomain but also the overall conformation of Pax6.


    Materials and Methods
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Oligonucleotides were purchased from Invitrogen (Frederick, MD), and mouse monoclonal antibody against Pax6 from Developmental Biology Hybridoma Bank (Iowa City, IA). 293T, an adenovirus-transformed human embryonic kidney epithelial cell line, was obtained from ATCC (Manassas, VA); mouse P19, undifferentiated embryonal carcinoma cells, were provided by Thomas Harris (Department of Molecular Genetics, Albert Einstein College of Medicine); CHO-K1, a Chinese hamster ovary cell line, was provided by Jonathan Backer (Department of Molecular Pharmacology, Albert Einstein College of Medicine); and N/N1003A, a rabbit nontransformed lens epithelial cell line, was provided by John Reddan (Oakland Eye Research Institute, Rochester, MI).

Expression Plasmids and Site-Directed Mutagenesis of DNA
Expression plasmids for PAX6 and PAX6(5a), and their mutants (G18W, R26G, A33P, S43P, G64V, I87R, V126D, R128C, R317X, and S353X) were made in the CMV-based vector, pKW1029 30 using a mutagenesis kit (QuickChange; Stratagene, La Jolla, CA). The mutants and their phenotypes are shown schematically in Figure 1 .

Electrophoretic Mobility Shift Assays
Three double-strand oligonucleotide (5'–3') probes corresponding to standard Pax6 binding sites were prepared (upper strands, area of Pax6 consensus binding site is italic): P6CON, TTCAGGAAAAATTTTCACGCTTGAGTTCACAGCTCGAGT; 5aCON, AAATCTGAACATGCTCAGTGAATGTTCATTGACTCTCGAGGTC, and HDCON (P3 site) TCGAGGGCATCAGGATGCTAATCTGATTAGCATCCGATCGGG. Electropho-retic mobility shift assays (EMSAs) with 1 ng of 5'-end–labeled probes were conducted as described earlier.31 The respective amounts of extracts used were normalized according to the Western immunoblot data.

Protein Expression and Western Blot Analysis
A panel of 22 Pax6 wild-type and mutated proteins, expressed in vitro in the TnT system driven by the SP6 promoter (Promega, Madison, WI) and in transiently cotransfected 293T, CHO-K1, and COP-8 cells, were analyzed to evaluate the expression levels and the integrity of the proteins. Nuclear extracts from cultured lens cells were used as the positive control. Protein concentrations were determined with a Coomassie Blue protein assay (Bio-Rad Laboratories, Hercules, CA), and 50 µg of protein was loaded in each lane of a 10% discontinuous SDS-PAGE gel (Bio-Rad). The protein was transferred to nitrocellulose and incubated with 1:2000 dilution of anti-Pax6 serum. Bound antibodies were detected with 1:2000 horseradish peroxidase (HRP)–linked anti-mouse IgG, as described earlier.12

Reporter Genes
Six, four, and four copies of the PAX6 PD, PD5a, and HD consensus binding sites, P6CON, 5aCON, and HDCON, respectively, were cloned 5' of the E4 TATA minimal promoter in pGL3 as described elsewhere.30

Cell Cultures, Transfections, and Dual Luciferase Assays
All except for N/N1003A cells were grown in DMEM with 10% fetal bovine serum supplemented with 20 µg/mL gentamicin, in a 5% CO2 incubator at 37°C. For N/N1003A, rabbit serum (Sigma-Aldrich, St. Louis, MO) was used. For P19 cells, the medium was supplemented with 2 mM L-glutamine. CHO-K1, 293T, P19, and N/N1003A cells were seeded at a density of 40% to 50% confluence in six-well plates the day before transfection. The medium was changed 2 to 3 hours before the cells were transfected by the calcium phosphate coprecipitation procedure. At 60% to 80% confluence, cells were transfected with 5 µg of firefly luciferase reporter DNA and different concentrations of expression vectors encoding PAX6/PAX6 mutants or PAX6(5a)/PAX6(5a) mutants, empty vector pKW10, or both. An internal control plasmid, pCMV Renilla luciferase, was included in all transfections. All the mutations were also tested in CHO-K1 cells cotransfected with the different plasmids, pSV40 and pTK Renilla luciferase (Promega), used for the normalization to control for possible indirect effects. The cells were kept in medium with 10% serum for 48 hours after transfection. Cells were passively lysed, and luciferase activity was measured at room temperature with a dual luciferase reporter assay kit (Promega). Firefly luciferase activities were normalized relative to Renilla luciferase activity. Each experiment was conducted in triplicate and repeated at least twice. The results shown in Figure 5 were calculated as ratios between the activity of mutated Pax6 protein (mutated PAX6 or mutated PAX6(5a)) divided by the activity of corresponding wild-type protein.



View larger version (42K):
[in this window]
[in a new window]
 
FIGURE 5. A summary of relative transactivation of 10 PAX6 and PAX6(5a) mutants compared with their wild-type counterparts. (A) Relative activation by PAX6 and PAX6(5a) compared with the absence of Pax6. (B) Relative activation of PAX6 or PAX6(5a) mutants compared with their respective wild-type counterparts. Changes less than 0.5-fold are in purple, between 0.5- and 0.8-fold in light purple, between 0.8- and 1.2-fold in light orange, between 1.2- and 1.5-fold in orange, and more than 1.5-fold in dark orange. The location of the mutation is shown in Figure 1 . The position of mutation is indicated by the corresponding subdomain: ß-linker; the PAI subdomain, PAI; the linker between PAI and RED subdomain, L; the RED subdomain, RED; and the activation domain, AD. The experiments were performed either with 200 ng of PAX6 or pKW10; or 50 ng of PAX6(5a) or pKW10 expression plasmid, respectively. The number of experiments used for the calculation was six or nine. The relative activation by wild-type PAX6 and PAX6(5a) are shown for comparison.

 

    Results
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
Naturally Occurring Human Missense and Nonsense PAX6 Mutations and Their Binding to DNA
Functional studies of natural mutants of PAX6 with distinct developmental defects are useful in understanding the molecular mechanisms of PAX6 and other PAX proteins. We prepared a representative panel of 10 naturally occurring PAX6 and PAX6(5a) mutants (Fig. 1) using site-directed mutagenesis. The mutation G18W is located in the ß-turn motif close to the N-terminal end of the PD, three mutations (R26G, A33P, and S43P) are located within the PAI subdomain, one mutation (G64V) is located in the linker between the PAI and RED subdomains, and three mutations (I87R, V126D, and R128C) are located in the RED subdomain (Fig. 1B) .28 Two nonsense mutations (R317X and S353X) result in premature termination of the C-terminal activation domain of PAX6 (Fig. 1C) . The selected mutations cause a broad spectrum of ocular defects (Table 1) , and mostly affect amino acid residues that are highly conserved in PDs of other Pax proteins.28 Three missense mutations (R26G, I87R, and R128C) had been characterized in functional and DNA-binding assays27 32 33 using the NIH 3T3, P19, B3 lens epithelial, or HeLa cell lines.


View this table:
[in this window]
[in a new window]
 
TABLE 1. Phenotypes and Functional Data of the Representative Human Mutants in PAX6

 
The DNA-binding properties of these PAX6 and PAX6(5a) mutants were tested using the "optimal" DNA-binding sites P6CON,34 5aCON,4 and HDCON30 for recombinant PD, PD(5a), and HD proteins, respectively. These "optimal" binding sites were obtained with GST-fusion proteins representing individual DNA-binding subdomains using enrichment of binding sites from pools of random sequences.4 30 34 Optimal binding sites for full-length PAX6 and PAX6(5a) remain to be determined. P6CON is a bipartite binding site31 34 in which the 5'-portion is strongly recognized by the PAI subdomain, and the 3'-half is recognized weakly by the RED subdomain (Fig. 2) . In contrast, 5aCON is recognized by RED subdomain,4 5 and HDCON is bound through the HD homodimer.30 Natural Pax6-binding sites are usually recognized by a combination of PAI, RED, and HD for PAX6 or RED and HD for PAX6(5a).31 The P6CON binding site is closest to the Pax6-binding site in the guinea pig {zeta}-crystallin promoter.35 The 5aCON binding site, as a tetramer for PD5a, was shown in mouse {gamma}E- and {gamma}F-crystallin promoters.5 36 Binding of Pax6 through both its HD and PD is important for the G1 element in the rat glucagon promoter.37 A sequence of ATTATGCTAAT (the HD-binding nucleotides are italic), along with three PD-binding sites, is present in the Pax6-responsive region of the rat c-Maf promoter.38 Thus, P6CON, 5aCON, and HDCON represent well the diversity of natural Pax6 DNA-binding sites.



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 2. Three distinct DNA-binding mechanisms of Pax6 proteins. The models were deduced using recombinant PD, PD(5a), and HD Pax6 proteins.4 5 30 34 The PD-binding site is a bipartite site. Its 5'-half dominantly and strongly binds the PAX6 PAI subdomain. In contrast, it does not bind the alternatively spliced PD(5a) PAI subdomain.4 31 Although the 3' half makes contacts with DNA in the crystal structure of the Pax6 PD with P6CON,28 it cannot bind the isolated PD(5a)4 31 and is considered to be a weak binding sequence. XXX: Areas of strong (i.e., optimal) binding; vertical bars: area of weaker binding.

 
The PAX6 series of proteins bound to P6CON with apparently different affinities (Fig. 3A) . In contrast, the mutants in the RED domain (mutations I87R, V126D, and R128C) compared with mutants affected in the PAI and linker region bound weakly to the 5aCON sites (Fig. 3B) . Similarly, the PAX6(5a) series of mutations, except G64V, I87R, and V126D, bound more to 5aCON sites compared with PAX6(5a) (Fig. 3C) . In addition, all recombinant PAX6(5a) proteins failed to bind the probe P6CON (data not shown), in agreement with earlier reports.4 31 Finally, none of the mutations tested impaired the DNA-binding properties of the mutated Pax6 protein tested with the HDCON sites (Figs. 3D 3E) although it appeared that a specific group of mutants (G18W, R26G, A33P, and S43P) formed dimers (Figs. 3E , lanes 3 to 6) rather than a monomer generated by PAX6(5a) (lane 2) on the HDCON oligonucleotide. A 50-M excess of identical cold oligonucleotides competed with the specific complexes (data not shown). Western immunoblot experiments showed comparable expression of all proteins (Fig. 3F) .



View larger version (57K):
[in this window]
[in a new window]
 
FIGURE 3. DNA-binding properties of PAX6 and PAX6(5a) proteins. EMSAs with wild-type and (A) mutated PAX6 series with P6CON, (B) mutated PAX6 proteins with 5aCON, (C) mutated PAX6(5a) series with 5aCON, (D) mutated PAX6 proteins with HDCON, and (E) mutated PAX6(5a) series with HDCON. Solid arrow: Specific complexes in (A) to (E) formed by full-length proteins (lanes 2–10). Open arrows: truncated complexes (lanes 11 and 12). () Presumptive dimers (see Refs. 4 5 31 ) formed by truncated Pax6 proteins (lanes 11 and 12). (E, open, wide arrow) Possible Pax6 dimers (lanes 36). (F) Western blot of PAX6 and PAX6(5a) and their missense mutants, to demonstrate comparable level of expression of proteins used in EMSAs.

 
Pleiotropic Effects of Naturally Occurring Missense Mutants in Pax6
To assess functional properties of both PAX6 and PAX6(5a) and their mutants in different cellular environments, we conducted cotransfections in CHO-K1, 293T, and P19 cell lines, as described in the Methods section. These cell lines do not express endogenous Pax6 proteins.39 In addition, we used the lens epithelial cell line N/N1003A, which expresses endogenous Pax6 proteins.29 35 To generate diverse reporter plasmids, we used six, four, and four copies of PAX6 PD, PD5a, and HD consensus binding sites cloned 5' of the E4 TATA region,4 30 34 as diagrammatically shown in Figure 4A . Initial experiments were performed to generate PAX6 and PAX6(5a) dose-dependent activation curves,30 to identify the optimal range of concentrations of the effector cDNAs. The data for CHO-K1, 293T, and P19 cell lines are shown in Figure 4 . Control experiments with the parental vector pKW10 and combinations of pKW10/Pax6 were conducted in parallel, to assure that the cytomegalovirus (CMV) promoter/enhancer and Pax6-driven promoters did not compete with each other using the concentrations tested. From these data, we decided to study PAX6 at 200 ng or PAX6(5a) at 50 ng amounts per transcriptional activation assay.



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 4. Pax6 dosage-dependent activation of transcription in three cell lines. (A) Schematic diagram of P6CON-, 5aCON-, and HDCON-driven promoters combined with the E4 TATA element. (B) Concentration dependence of the transactivation function of PAX6 in the P19, CHO-K1, and 293T cell lines. (C) Concentration dependence of the transactivation function of PAX6(5a) in the P19, CHO-K1, and 293T cell lines. The results were calculated as ratios of light units obtained in the presence of given amount of PAX6 or PAX6(5a) cDNA divided by the value obtained in the presence of the corresponding amount of empty vector, pKW10.

 
The results of cotransfections of PAX6 and PAX6(5a) panels using P6CON, 5aCON, and HDCON reporters in CHO-K1, 293T, P19, and N/N1003A cell lines are shown in Fig. 5 . Relative transactivation of these reporters by wild-type PAX6 or PAX6(5a) is shown in Figure 5A . In the absence of endogenous Pax6 proteins, PAX6 activated these reporters in the range between 2.7 and 17.0 in P19, CHO-K1, and 293T cells. Similarly, the highest level of PAX6(5a) activation was 7.3-fold with 5aCON-reporter and in P19 cells. Next, individual mutants of PAX6 or PAX6(5a) were tested, and the data were expressed as relative ratios between the activation by Pax6 mutants and its corresponding wild-type counterpart (see Fig. 5B ). For example, the G18W mutant of PAX6 tested with P6CON in P19 cells gave a change in expression of 0.2; thus, the reporter was still activated by a factor of 3.4. Similarly, the R26G mutant of PAX6(5a) tested with 5aCON in P19 cells gave a change of 10.3-fold. Hence, the reporter was activated by a factor of 75.2-fold. The data are analyzed from the contribution of cellular environment, type of mutations and their physical location, and specific Pax6 DNA-binding mechanism. Because N/N1003A cells differed from other cell lines by endogenous Pax6 expression, their results are presented separately (see below). Generally, the data (Fig. 5) show that the cellular environment of Pax6 plays an important role in gene activation, as identical mutations display different outcomes in different cells. This finding is consistent with in vivo observations that only specific ocular cells and tissues expressing Pax6 are affected in Pax6 heterozygotes.10 13 14 15 16 17 18 19 20 21 22 26

Structural and functional analyses between the position of individual mutations and their effect on transcriptional activation resulted in both correlative and sometimes unexpected properties (Fig. 5B) , as described in detail later. The G18W mutation in PAX6 yielded reduced activation that was independent of the Pax6 DNA-binding mechanism. In contrast, this mutation in PAX6(5a) resulted in a moderate activation up to twofold, in no change, or in moderate reduction of activity (down to 0.5–0.7-fold) depending on the cell line (Fig. 5B) .

Three mutations in the PAI subdomain, studied in PAX6, yielded either a reduction or no change in activity, except for R26G activating on 5aCON. Each PAX6 G18W, R26G, A33P, and S43P could bind in vitro P6CON (Fig. 3A , lanes 3–6). In contrast, these mutations in PAX6(5a) had variable properties that were dependent on the Pax6 DNA-binding mechanism. No potentially significant changes (i.e., those changes lying between 0.7–1.3-fold) were observed if P6CON binding sites were used, in agreement with the prediction that the P6CON sequence is not sufficient for PAX6(5a) binding (Fig. 2) .12 All three PAI mutations in PAX6(5a) generated superactivation (i.e., activation between 1.7–13.4-fold higher than the activation by wild type PAX6(5a)) from 5aCON templates.

A linker mutation, G64V, located close to the PAI subdomain, exhibited a pleiotropic impact (Fig. 5B) . In PAX6, it resembled other PAI mutations. However, in PAX6(5a) this mutation caused a reduction in the activity (e.g., with 5aCON-driven reporters in P19 and 293T cells) or an increase (e.g., with 5aCON-con driven reporters in CHO-K1 cells).

Three mutations, I87R, V126D, and R128C, located in the RED subdomain, affected PAX6- and PAX6(5a)-mediated transactivation with apparent dependence on the DNA-binding mechanism and cellular context (Fig. 5B) . In PAX6, these mutations enhanced transactivation of P6CON-driven reporters in P19 but not in 293T cells, consistent with their ability to bind P6CON (Fig. 3B , lanes 8–10). In CHO-K1 cells, these mutations yielded both reduction (I87R mutation) and hyperactivation (V126D and R128C mutations). These mutants bound in vitro P6CON with higher affinity than PAX6 (Fig. 3B , compare lane 2 with lanes 9 and 10). This behavior was consistent with earlier data showing that P6CON contains an optimal sequence for PAI recognition, but not for efficient binding of the RED subdomain (Fig. 2) .4 5 31 Thus, mutations in the RED subdomain, depending on the specific cellular context, can either act as gain- or loss-of-function mutations using the P6CON-binding mechanism. PAX6(5a) activated transcription (by 2.9-fold) from P6CON in CHO-K1 cells, but not in P19 and 293T cells. The data again show that an identical PAX6(5a) mutation can act as a loss-of-function mutation (e.g., V126D in P19 and 293T cells), or gain-of-function mutation (in CHO-K1 cells).

Both nonsense mutations (R317X and S353X) in PAX6 yielded reduced transactivation levels using all three DNA-binding mechanisms (Fig. 5B) . This is in agreement with the idea that any C-terminal deletion of PAX6 negatively affects its capacity to activate transcription.14 16 40 41 However; in PAX6(5a), this assumption is not always true. Most notably, S353X either does not have any effect when tested with a P6CON-driven promoter (i.e., in P19 and 293T cells), or it can promote transcription in CHO-K1 cells twofold.

Although CHO-K1, 293T, and P19 cell lines are best suited to study the function of individual Pax6 mutants, it was of interest to examine these mutations in the cellular environment where Pax6 is normally expressed—in this case, in lens epithelial cells N/N1003A.29 35 Thus, we conducted a similar set of transfection experiments, and the results are summarized in Figure 5 . In contrast to properties of mutants I87R, V126D, and R128C in P19 and CHO-K1 cells, no superactivation was found for the PAX6 series. Twenty of 24 tests performed with eight missense mutations caused reduced activity. However, mutations in PAX6(5a) tested in N/N1003A cells yielded a significant proportion of superactivations (9/24 tests), and only four reactions resulted in reduced activities. Finally, both nonsense mutations, R317X and S353X, tested in N/N1003A lens cells behaved according to patterns found in non–lens cells described earlier.


    Discussion
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 
The goal of the present study was to determine the functional properties of 10 representative human PAX6 mutants, and to analyze the structural and functional relationship among them. Understanding of functional properties of Pax6 proteins is important for elucidation of the molecular mechanism of PAX6 as a transcription factor, for a better understanding of the role of Pax6 during development, and for understanding of natural mutations in other PAX genes (e.g., PAX2 and PAX3).42

Structure and Function of Human PAX6 Missense Mutants
The present data show that mutations in Pax6 tested individually show a spectrum of responses: identical mutations in PAX6 and PAX6(5a) could reduce, enhance, or leave transcription unchanged, depending on a specific cellular environment (Fig. 5) . These differences did not originate from different stabilities of the expressed proteins, as the mutants were expressed intact (data not shown) and in agreement with earlier studies addressing this possibility.16 19 32 40

Our study provides surprising answers to predictions based on the crystal structure of Pax6 PD bound to DNA.28 Analysis of the PAI helix-turn-helix and its N-terminal ß-turn region revealed critical contacts between glycine 18 and arginine 26 and DNA and suggested that proline substitutions for arginine 33 and serine 43 would be disruptive to the PAI folding. Our functional data combined with DNA-binding properties of Pax6 mutants showed that individual mutations affecting the amino acids at positions 18, 26, 33, and 43 did not abrogate binding of either PAX6 or PAX6(5a) to DNA, and yet, they caused mostly reduced transcriptional activations. The reductions were more profound in 293T cells, but were weak in CHO-K1 cells. We propose that misfolding of PAI caused by substitutions A33P and S43P may affect the Pax6 conformation and, consequently, its protein-protein interactions with the transcriptional machinery. In contrast, RED contacts with DNA are still uncertain,28 as the optimal binding site for PD(5a) is different from the optimal binding site for PD.5 30 31 34 Thus, in the tentative model of RED, arginine 128 makes direct contact with DNA, and isoleucine 87 and valine 126 constitute a hydrophobic core of the RED subdomain.28 The functional variability of mutants affecting residues 87, 126, and 128, using the 5aCON optimal and P6CON suboptimal site, implies that interactions of RED with DNA remain to be established. Mutation R128C actually enhanced binding of the corresponding full-length PAX6 to P6CON (Fig. 3A , lane 10), although reduced binding of an isolated mutated PD (R128C) was observed earlier.27

Role of Cellular Environment
Earlier functional studies of human Pax6 mutations were limited to studies of a small number of mutations, and typically used a single reporter plasmid.16 27 32 33 43 In addition, the cell lines were variably chosen and did not allow direct comparisons between experiments. We used four commonly available cell lines to standardize the assays. The data clearly show that different cellular environments provided by cell lines of different origin affect the properties of most of the mutants tested. Although we do not know the precise molecular mechanism, the present data suggest several possibilities. We show that missense mutations affecting the N-terminal region of the Pax6 PD (i.e., G18W, R26G, A33P, S43P, and G64V) mostly activated transcription in the range of 2- to 13-fold from 5aCON-driven reporter plasmids, though the PD5a was excluded from binding to DNA.4 5 It is likely that these missense mutations induce conformational changes in the entire Pax6 proteins and not only in the respective structural subdomain. A direct indication of this possibility is the variation in the mobility of both the PAX6/5aCON (see Fig. 3B ) and PAX6(5a)/5aCON complexes (see Fig. 3C ) caused by different conformation of the protein and/or bending of the DNA when the Pax6-DNA complex forms. Consequently, Pax6-mutated proteins may differently interact with tissue-restricted proteins of the transcriptional machineries resulting in the observed variabilities. This characteristic of missense mutations in Pax6 is consistent with the in vivo observations that these mutations result in moderate ocular phenotypes compared with the classic aniridia due to the loss of one PAX6 allele. A specific missense mutation may display its detrimental effect in only one or a few sensitive tissues (e.g., G18W and R26G may affect only the lens and cornea).15 17

In conclusion, the present study shows that missense PAX6 mutations should be tested with multiple functional assays and that these mutations are likely to be useful to map protein–protein interactions between Pax6 proteins and other protein components of the transcriptional machinery.


    Acknowledgements
 
The authors thank Barbara Birshtein for helpful suggestions; Meinrad Busslinger and Richard Maas for reagents used in the study; Ronald Burde, Scott Emmons, Harry Engel, and Raju Kucherlapati for encouragement during the course of this work; and members of DNA Core Sequencing of the Albert Einstein College of Medicine for their excellent service.


    Footnotes
 
Supported by National Eye Institute Grant EY12200. AC is a recipient of a Research to Prevent Blindness, Inc. Career Development Award.

Submitted for publication September 3, 2003; revised October 2, 2003; accepted October 17, 2003.

Disclosure: B.K. Chauhan, None; Y. Yang, None; K. Cveklová, None; A. Cvekl, None

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: Ales Cvekl, Departments of Ophthalmology and Visual Sciences and Molecular Genetics, Albert Einstein College of Medicine, 909 Ullmann, 1300 Morris Park Avenue, Bronx, NY 10461; cvekl{at}aecom.yu.edu.


    References
 Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Chi N, Epstein JA. Getting your Pax straight: Pax proteins in development and disease. Trends Genet. 2002;18:41–47.[CrossRef][ISI][Medline][Order article via Infotrieve]
  2. Jun S, Desplan C. Cooperative interactions between paired domain and homeodomain. Development. 1996;122:2639–2650.[Abstract]
  3. Carriere C, Plaza S, Martin P, et al. Characterization of quail Pax-6 (Pax-QNR) proteins expressed in the neuroretina. Mol Cell Biol. 1993;13:7257–7266.[Abstract/Free Full Text]
  4. Epstein JA, Glaser T, Cai J, Jepeal L, Walton DS, Maas RL. Two independent and interactive DNA-binding subdomains of the Pax6 paired domain are regulated by alternative splicing. Genes Dev. 1994;8:2022–2034.[Abstract/Free Full Text]
  5. Kozmik Z, Czerny T, Busslinger M. Alternatively spliced insertions in the paired domain restrict the DNA sequence specificity of Pax6 and Pax8. EMBO J. 1997;16:6793–6803.[CrossRef][ISI][Medline][Order article via Infotrieve]
  6. Callaerts P, Halder G, Gehring WJ. PAX-6 in development and evolution. Annu Rev Neurosci. 1997;20:483–532.[CrossRef][ISI][Medline][Order article via Infotrieve]
  7. Cvekl A, Piatigorsky J. Lens development and crystallin gene expression: many roles for Pax-6. Bioessays. 1996;18:621–630.[CrossRef][ISI][Medline][Order article via Infotrieve]
  8. Glaser T, Walton DS, Cai J, Epstein JA, Jepeal L, Maas RL. PAX6 gene mutations in aniridia. Wigg J eds. Molecular Genetics of Ocular Disease. 1995;55–81. John Wiley & Sons New York.
  9. Mansouri A, St-Onge L, Gruss P. Role of Genes in endoderm-derived organs. Trends Endocrinol Metab. 1999;10:164–167.[CrossRef][ISI][Medline][Order article via Infotrieve]
  10. Van Heyningen V, Williamson KA. PAX6 in sensory development. Hum Mol Genet. 2002;11:1161–1167.[Abstract/Free Full Text]
  11. Chow RL, Lang RA. Early eye development in vertebrates. Annu Rev Cell Dev Biol. 2001;17:255–296.[CrossRef][ISI][Medline][Order article via Infotrieve]
  12. Baulmann DC, Ohlmann A, Flugel-Koch C, Goswami S, Cvekl A, Tamm ER. Pax6 heterozygous eyes show defects in chamber angle differentiation that are associated with a wide spectrum of the other anterior eye segment abnormalities. Mech Dev. 2002;118:3–17.[CrossRef][ISI][Medline][Order article via Infotrieve]
  13. Davis A, Cowell JK. Mutations in the PAX6 gene in patients with hereditary aniridia. Hum Mol Genet. 1993;2:2093–2097.[Abstract/Free Full Text]
  14. Glaser T, Jepeal L, Edwards JG, Young SR, Favor J, Maas RL. PAX6 gene dosage effect in a family with congenital cataracts, aniridia, anophthalmia and central nervous system defects. Nat Genet. 1994;7:463–471.[CrossRef][ISI][Medline][Order article via Infotrieve]
  15. Hanson IM, Fletcher JM, Jordan T, et al. Mutations at the PAX6 locus are found in heterozygous anterior segment malformations including Peters’ anomaly. Nat Genet. 1994;6:168–173.[CrossRef][ISI][Medline][Order article via Infotrieve]
  16. Singh S, Tang HK, Lee JY, Saunders GF. Truncation mutations in the transactivation region of PAX6 result in dominant-negative mutants. J Biol Chem. 1998;273:21531–21541.[Abstract/Free Full Text]
  17. Wolf MT, Lorenz B, Winterpacht A, et al. Ten novel mutations found in aniridia. Hum Mutat. 1998;12:304–313.[CrossRef][ISI][Medline][Order article via Infotrieve]
  18. Hanson I, Churchill A, Love J, et al. Missense mutations in the most ancient residues of the PAX6 paired domain underlie a spectrum of human congenital diseases. Hum Mol Genet. 1999;8:165–172.[Abstract/Free Full Text]
  19. Mishra R, Gorlov IP, Chao LY, Singh S, Saunders GF. PAX6, paired domain influences sequence recognition by the homeodomain. J Biol Chem. 2002;277:49488–49494.[Abstract/Free Full Text]
  20. Morrison D, FitzPatrick D, Hanson I, et al. National study of microphthalmia, anophthalmia, and coloboma (MAC) in Scotland: investigation of genetic aetiology. J Med Genet. 2002;39:16–22.[Abstract/Free Full Text]
  21. Sale MM, Craig JE, Charlesworth JC, et al. Broad phenotypic variability in a single pedigree with a novel 1410delC mutation in the PST domain of the PAX6 gene. Hum Mutat. 2002;20:322–330.
  22. Chao LY, Mishra R, Strong LC, Saunders GF. Missense mutations in the DNA-binding region and termination codon in PAX6. Hum Mutat. 2003;21:138–145.[CrossRef][ISI][Medline][Order article via Infotrieve]
  23. Sisodiya SM, Free SL, Williamson KA, et al. PAX6 haploinsufficiency causes cerebral malformation and olfactory dysfunction in humans. Nat Genet. 2001;28:214–216.[CrossRef][ISI][Medline][Order article via Infotrieve]
  24. Hittner HM. Aniridia. Ritch R Shields MB Krupin T eds. The Glaucomas. 1989;869–884. CV Mosby St. Louis.
  25. Nelson LB, Spaeth GL, Nowinski TS, Margo CE, Jackson L. Aniridia. A review. Surv Ophthalmol. 1984;28:621–642.[CrossRef][ISI][Medline][Order article via Infotrieve]
  26. Prosser J, van Heyningen V. PAX6 mutations reviewed. Hum Mutat. 1998;11:93–108.[CrossRef][ISI][Medline][Order article via Infotrieve]
  27. Yamaguchi Y, Sawada J, Yamada M, Handa H, Azuma N. Autoregulation of Pax6 transcriptional activation by two distinct DNA-binding subdomains of the paired domain. Genes Cells. 1997;2:255–261.[Abstract]
  28. Xu HE, Rould MA, Xu W, Epstein JA, Maas RL, Pabo CO. Crystal structure of the human Pax6 paired domain-DNA complex reveals specific roles for the linker region and carboxy-terminal subdomain in DNA binding. Genes Dev. 1999;13:1263–1275.[Abstract/Free Full Text]
  29. Cvekl A, Kashanchi F, Sax CM, Brady JN, Piatigorsky J. Transcriptional regulation of the mouse {alpha}A-crystallin gene: activation dependent on a cyclic AMP-responsive element (DE1/CRE) and a Pax-6-binding site. Mol Cell Biol. 1995;15:653–660.[Abstract]
  30. Czerny T, Busslinger M. DNA-binding and transactivation properties of Pax-6: three amino acids in the paired domain are responsible for the different sequence recognition of Pax-6 and BSAP(Pax-5). Mol Cell Biol. 1995;15:2858–2871.[Abstract]
  31. Duncan MK, Kozmik Z, Cveklova K, Piatigorsky J, Cvekl A. Overexpression of PAX6(5a) in lens fiber cells results in cataract and upregulation of {alpha}5ß1 integrin expression. J Cell Sci. 2000;113:3173–3185.[Abstract]
  32. Singh S, Stellrecht CM, Tang HK, Saunders GF. Modulation of PAX6 homeodomain function by the paired domain. J Biol Chem. 2000;275:17306–17313.[Abstract/Free Full Text]
  33. Tang HK, Chao LY, Saunders GF. Functional analysis of paired box missense mutations in the PAX6 gene. Hum Mol Genet. 1997;6:381–386.[Abstract/Free Full Text]
  34. Epstein J, Cai J, Glaser T, Jepeal L, Maas R. Identification of a Pax paired domain recognition sequence and evidence for DNA-dependent conformational changes. J Biol Chem. 1994;269:8355–8361.[Abstract/Free Full Text]
  35. Richardson J, Cvekl A, Wistow G. Pax-6 is essential for lens-specific expression of {zeta}-crystallin. Proc Natl Acad Sci USA. 1995;92:4676–4680.[Abstract/Free Full Text]
  36. Kralova J, Czerny T, Spanielova H, Ratajova V, Kozmik Z. Complex regulatory element within the {gamma}E- and {gamma}F-crystallin enhancers mediates Pax6 regulation and is required for induction by retinoic acid. Gene. 2002;286:271–282.[CrossRef][ISI][Medline][Order article via Infotrieve]
  37. Ritz-Laser B, Estreicher A, Klages N, Saule S, Philippe J. Pax-6 and Cdx-2/3 interact to activate glucagon gene expression on the G1 control element. J Biol Chem. 1999;274:4124–4132.[Abstract/Free Full Text]
  38. Sakai M, Serria MS, Ikeda H, Yoshida K, Imaki J, Nishi S. Regulation of c-maf gene expression by Pax6 in cultured cells. Nucleic Acids Res. 2001;29:1228–1237.[Abstract/Free Full Text]
  39. Chauhan BK, Yang Y, Cveklova K, Cvekl A. Synergistic interactions between PAX6 and PAX6(5a)-mediated gene regulation and haploinsufficiency. Nucleic Acids Res. .Submitted
  40. Duncan MK, Haynes JI, II, Cvekl A, Piatigorsky J. Dual roles for Pax-6: a transcriptional repressor of lens fiber cell-specific ß-crystallin genes. Mol Cell Biol. 1998;18:5579–5586.[Abstract/Free Full Text]
  41. Duncan MK, Cvekl A, Li X, Piatigorsky J. Truncated forms of Pax-6 disrupt lens morphology in transgenic mice. Invest Ophthalmol Vis Sci. 2000;41:464–473.[Abstract/Free Full Text]
  42. Semenza G. PAX proteins. New Y eds. Transcription Factors and Human Diseases. 1998;169–198. Oxford University Press New York.
  43. Mikkola I, Bruun JA, Holm T, Johansen T. Superactivation of Pax6-mediated transactivation from paired domain-binding sites by DNA-independent recruitment of different homeodomain proteins. J Biol Chem. 2001;276:4109–4118.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
T. Grocott, V. Frost, M. Maillard, T. Johansen, G. N. Wheeler, L. J. Dawes, I. M. Wormstone, and A. Chantry
The MH1 domain of Smad3 interacts with Pax6 and represses autoregulation of the Pax6 P1 promoter
Nucleic Acids Res., February 16, 2007; 35(3): 890 - 901.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
B. K. Chauhan, Y. Yang, K. Cveklova, and A. Cvekl
Functional interactions between alternatively spliced forms of Pax6 in crystallin gene regulation and in haploinsufficiency
Nucleic Acids Res., March 12, 2004; 32(5): 1696 - 1709.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (10)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chauhan, B. K.
Right arrow Articles by Cvekl, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chauhan, B. K.
Right arrow Articles by Cvekl, A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS