IOVS Annual Reviews: Physical Science Suite
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

(Investigative Ophthalmology and Visual Science. 2004;45:2497-2502.)
© 2004 by The Association for Research in Vision and Ophthalmology, Inc.
DOI:  10.1167/iovs.03-1373
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chi, Z.-L.
Right arrow Articles by Cui, H.-S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chi, Z.-L.
Right arrow Articles by Cui, H.-S.

Effects of Rolipram, a Selective Inhibitor of Type 4 Phosphodiesterase, on Lipopolysaccharide-Induced Uveitis in Rats

Zai-Long Chi, Seiji Hayasaka, Xue-Yun Zhang, Yoriko Hayasaka, and Hu-Shan Cui

From the Department of Ophthalmology, Toyama Medical and Pharmaceutical University, Toyama, Japan.


   Abstract
Top
 Abstract
Materials and Methods
 Results
 Discussion
 References
 
PURPOSE. To investigate effects of rolipram, an inhibitor of type 4 phosphodiesterase, on lipopolysaccharide (LPS)-induced uveitis in Wistar rats.

METHODS. A total of 100 µg LPS was injected into the rat footpad. Rolipram (Wako Pure Chemical, Osaka, Japan) was injected intraperitoneally 30 minutes before administration of LPS. Levels of intracameral protein, cells, E-selectin, tumor necrosis factor (TNF)-{alpha}, interleukin (IL)-6, and nitrite were determined. E-selectin, TNF-{alpha}, IL-6, and inducible nitric oxide synthase (iNOS) mRNAs and immunohistochemical reactivity of nuclear factor (NF)-{kappa}B and TNF-{alpha} were also examined in the iris-ciliary body.

RESULTS. After LPS injection, intracameral protein and cells increased from 18 to 30 hours later. Rolipram, however, inhibited elevation of protein and cells. After LPS injection, mRNA levels of E-selectin, TNF-{alpha}, and IL-6 in the iris-ciliary body increased 3 hours later, and iNOS mRNA increased 6 hours later. Elevation of mRNA levels for E-selectin, TNF-{alpha}, and IL-6 was inhibited by rolipram. After LPS injection, intracameral TNF-{alpha} and IL-6 levels increased 4 to 6 hours later, and nitrite levels increased 14 to 20 hours later. Elevation of TNF-{alpha} and IL-6 levels was decreased by rolipram. Rolipram did not affect iNOS mRNA and nitrite levels. Immunoreactivity of NF-{kappa}B was strong 1 hour after LPS injection, and was decreased by rolipram. Immunoreactivity of TNF-{alpha} was strong 4 hours after LPS injection and was decreased by rolipram.

CONCLUSIONS. NF-{kappa}B translocation and expression of E-selectin, TNF-{alpha}, and IL-6 are involved in the pathogenesis of LPS-induced uveitis and are inhibited by rolipram. The inhibitory effect of rolipram in uveitis may be independent of iNOS synthesis.

Endotoxin (lipopolysaccharide; LPS)-induced uveitis in rats is a known model of human disease.1 Interleukin (IL)-6, tumor necrosis factor (TNF)-{alpha}, E-selectin, and nitric oxide (NO) production have been reported to be involved in the pathogenesis of LPS-induced inflammation and uveitis.2 3 4 5 6 7 8 9 IL-6 and TNF-{alpha} are known as proinflammatory cytokines,5 and E-selectin contributes to continuing cellular infiltration into the site during inflammation.4 Immunologic and inflammatory stimuli induce the expression of the inducible isoform of nitric oxide synthase (iNOS), producing NO.10 LPS has induced translocation of nuclear factor (NF)-{kappa}B, an inducible transcription factor that mediates the overproduction of TNF-{alpha} and other cytokines.11

Phosphodiesterase type 4 is reportedly a major cAMP-hydrolyzing isoenzyme in proinflammatory cells, including T-lymphocytes, monocytes, neutrophils, and eosinophils.12 13 14 15 Rolipram, a type 4 phosphodiesterase inhibitor, suppresses cutaneous inflammation,16 zymosan-induced inflammation,17 LPS-induced TNF-{alpha} expression,18 and collagen-induced arthritis.19 Xu et al.20 have demonstrated the protective effect of rolipram in experimental autoimmune uveoretinitis and have reported that the protection is independent of IL-10–induced activity. Blease et al.21 have reported that rolipram, in combination with salbutamol inhibited TNF-{alpha}, induces E-selectin expression. Sanz et al.22 have demonstrated that rolipram inhibits leukocyte–endothelial cell interactions in vivo through P- and E-selectin downregulation. Rolipram is used as an antidepressant.23 In the present study, in a model of LPS-induced uveitis in Wistar rats, we determined the number of cells and amount of protein in the aqueous humor and the mRNA and protein levels of IL-6, TNF-{alpha}, E-selectin, and nitrite and of NF-{kappa}B.


   Materials and Methods
Top
 Abstract
 Materials and Methods
Results
 Discussion
 References
 
Animals
A total of 206 male Wistar rats (6–8 weeks old, 170–200 g) was obtained from Sankyo Labo Service Co., Inc. (Tokyo, Japan). The animals were housed in 12-hour light–dark conditions and were given food and water ad libitum during the experiment. All studies were conducted in compliance with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. The study was approved by the Institutional Committee for the Ethics in Animal Care and Treatment.

Injection of LPS and Rolipram
To produce uveitis, LPS (Escherichia coli, serotype 055:B5; Sigma-Aldrich, St. Louis, MO) in 100 µg/100 µL pyrogen-free 0.9% sodium chloride was injected into one hind footpad. Rats treated with 0.9% sodium chloride alone served as the control. Rolipram (4-(3-[cyclopentyloxy]-4-methoxyphenyl)-2-pyrrolidinone) was purchased from Wako Pure Chemical (Osaka, Japan), dissolved in 3% dimethyl sulfoxide (DMSO), and injected intraperitoneally 30 minutes before administration of LPS. The treatments were performed between 9 and 11 AM.

Measurement of Protein and Number of Cells in the Aqueous Humor
Aqueous humor was aspirated several hours after injection of LPS. After intraperitoneal injection of pentobarbital (50 mg/kg body weight) aqueous humor was aspirated with a 30-gauge needle under visualization with a microscope. Aspirated samples were centrifuged at 1500 rpm for 5 minutes at 4°C to obtain the supernatant. Protein concentration in the supernatant was measured by a protein-dye–binding assay, as described by Bradford,24 and was expressed relative to a bovine serum albumin standard. To 5 µL of aspirated aqueous humor the same volume of 0.4% trypan blue was added. The stained cells were then counted with a hemocytometer.

RNA Extraction and Real-Time Polymerase Chain Reaction
After intraperitoneal injection of pentobarbital (50 mg/kg body weight) the eye globe was enucleated and immediately submerged in RNA stabilization reagent (RNALater; Qiagen, Hilden, Germany), followed by isolation of the iris-ciliary body tissue from the stabilized eye globe. The dissected iris-ciliary body tissue was homogenized with a rotor-stator homogenizer in buffer (RLT; Qiagen). Total RNA was extracted with a kit (RNeasy Protect Mini Kit; Qiagen) and treated with RNase-free DNase (Qiagen) to remove any residual genomic DNA. cDNA from each sample was obtained by reverse transcription with random hexamers using reverse transcriptase (Multiscribe; Applied Biosystems Inc., [ABI], Tokyo, Japan).

Based on the database, real-time PCR primers and probes (Nippon EGT, Tokyo, Japan) were designed for E-selectin (GenBank accession no. L25527; http://www.ncbi.nlm.nih.gov/Genbank; provided in the public domain by the National Center for Biotechnology Information, Bethesda, MD): forward primer 5'-GCCATGTGGT-TGAATGTAAAGC-3', reverse primer 5'-GGATTTGAGGAACATTTC-CTGACT-3', and 5'-(FAM)TTGACCCAACCTGCCCACG(TAMRA)-3' (TaqMan probe; ABI); for TNF-{alpha} (accession no. NM012675): forward primer 5'-ACAAGGCTGCCCCGACTAC-3', reverse primer 5'-TCCTGGTATGAAATGGCA AACC-3', and probe 5'-(FAM)TGCTCCTCACCCACACCGTCAGC(TAMRA)-3' (TaqMan; ABI); for IL-6 (accession no. NM012589): forward primer 5'-TCAACTCCATCTGCCCTTCAG-3', reverse primer 5'-AAGGCAACTGGCTGGAAGTCT-3', and 5'-(FAM)AACAGCTATGAAGTTTCTCTCCGCA(TAMRA)-3' (TaqMan probe; ABI); for iNOS (accession no. NM012611): forward primer 5'-TGGTCCAACCTGCAGGTCTT-3', reverse primer 5'-CAGTAATGGCCGACCTGAT-GT-3', and 5'-(6-FAM)TGCCCGGAGCTGTAGCACTGCAT(TAMRA)-3' (TaqMan probe; ABI); and for glyceraldehyde 3-phosphate dehydrogenase (GAPDH, accession no. AF106860): forward primer 5'-CCGAGGGCC-CACTAAAGG-3', reverse primer 5'-GCTGTTGAAGTCACAGGAGACAA-3', and 5'-(FAM)CATCCTGGGCTACAC TGAGGACCA(TAMRA)-3' (TaqMan probe; ABI).

cDNA was used to detect real-time PCR products for E-selectin, TNF-{alpha}, IL-6, and iNOS with master mix (TaqMan Universal Master Mix; ABI) and a sequence detection system (Prism 7700; ABI) with specific primers and probe. The thermal profile for each primer consisted of 2 minutes at 50°C and 10 minutes at 95°C, followed by 40 cycles for 15 seconds at 95°C and 1 minute at 60°C. To compare expression patterns, mRNA template concentrations of GAPDH and the target genes were calculated using the standard curve method. The expression levels of E-selectin, TNF-{alpha}, IL-6, and iNOS mRNA were normalized by the GAPDH mRNA level in each sample, and the changes were expressed as an n-fold increase, relative to the levels in control rats treated with 0.9% NaCl alone.

Protein Levels of TNF-{alpha} and IL-6 in the Aqueous Humor
After LPS injection, aqueous humor was aspirated with a 30-gauge needle under microscopic visualization. Aspirated samples were centrifuged at 2500 rpm for 20 minutes at 4°C to obtain the supernatant. Protein levels of TNF-{alpha} and IL-6 were determined by an enzyme-linked immunosorbent assay (AN'ALYZA; Techne Corp., Minneapolis, MN).

Nitrite Levels in Aqueous Humor
The nitrite level in the aqueous humor was measured colorimetrically by using a nitrite oxide assay kit (EMD Biosciences, Darmstadt, Germany), according to the manufacturer’s instruction. The aqueous humor from both eyes of a rat was diluted up to 40 µL and used for one assay.

Immunohistochemistry for Subunit p65 of NF-{kappa}B and TNF-{alpha}
Rats were anesthetized with an intraperitoneal injection of pentobarbital and were perfusion fixed with 4% cold paraformaldehyde in phosphate-buffered saline (PBS) at various times (n = 4 for each time point). The eyes were enucleated, cut in half, and fixed with 4% paraformaldehyde in PBS for 30 minutes at 4°C.

For subunit p65 of NF-{kappa}B, fixed specimens were embedded in paraffin and sectioned at 5 µm. The sections were immunostained with a rabbit avidin-biotin complex (ABC) staining system (Santa Cruz Biotechnology, Santa Cruz, CA), according to the manufacturer’s instructions. Sections were deparaffinized in xylene and hydrated with graded ethanol. Slides were boiled in target retrieval solution buffer (Dako, Kyoto, Japan) in a microwave for 4 minutes and then placed at room temperature for 20 minutes. Endogenous peroxidase activity in the tissue was quenched with 1% hydrogen peroxide in PBS for 10 minutes. After blocking with 1.5% normal goat serum in PBS, slides were incubated with rabbit anti-rat NF-{kappa}B polyclonal antibody (Santa Cruz Biotechnology) for 1 hour. Biotinylated secondary antibody (goat anti-rabbit IgG) and avidin-biotinylated horseradish peroxidase-complex reagent was applied, respectively, for 30 minutes each. Also, 3,3'-diaminobenzidine (Dako) was used as a chromogenic substrate. The sections were counterstained with hematoxylin (Wako Pure Chemicals, Osaka, Japan) and mounted (Aquatex; Merck, Darmstadt, Germany). To verify the binding specificity for NF-{kappa}B, some sections were also incubated with normal goat IgG or without the primary antibody (data not shown).

For TNF-{alpha}, specimens were OCT embedded, frozen, cryosectioned at 10 µm, and subjected to immunofluorescence staining. After blocking with 10% normal bovine serum in PBS, slides were incubated with goat anti-rat TNF-{alpha} polyclonal antibody (Santa Cruz Biotechnology) for 1 hour and immunolabeled with Texas red–conjugated bovine anti-goat IgG secondary antibody for 30 minutes. To verify the binding specificity for TNF-{alpha}, some sections were also incubated with normal bovine IgG or the primary antibody was omitted (data not shown).

Statistics
All data are expressed as the mean ± SD. Statistical analysis was performed using the Scheffé procedure for multiple comparisons of means. P < 0.05 was considered statistically significant.


   Results
Top
 Abstract
 Materials and Methods
 Results
Discussion
 References
 
Animals
No marked changes in body weight were noted after injection of LPS and rolipram. A small number of rats treated with 30 µmol/kg rolipram showed mild alterations in behavior including hypoactivity, forepaw shaking, grooming activity, and head twitches.

Protein and Cells in the Aqueous Humor
In our preliminary study, no elevation of intracameral cells and protein was found after 10 µg of LPS was injected, whereas marked elevation of intracameral cells and protein was observed after 300 µg of LPS was administered. After injection of 100 µg LPS into the rat footpad, protein in the aqueous humor increased at 6 hours, reached maximum levels (21 ± 2.2 mg/mL) at 18 to 30 hours, and then gradually decreased. Rolipram injected 30 minutes before LPS administration inhibited elevation of intracameral protein in a dose-dependent manner (15–30 µmol/kg) 24 hours after LPS administration (Fig. 1) . At 30 µmol/kg, rolipram decreased the protein level (10.6 ± 1.4 mg/mL). No cells were found in the aqueous humor of rats treated with 0.9% NaCl (Fig. 2) . Cells (35 ± 15 x 105/mL) were present in the aqueous humor of rats 24 hours after LPS injection. Rolipram inhibited the increase in number of cells in the aqueous humor in a dose-dependent manner (15–30 µmol/kg) 24 hours after LPS administration. Rolipram (30 µmol/kg) decreased the number of cells to 5 ± 4 x 105/mL.



View larger version (13K):
[in this window]
[in a new window]
  		FIGURE 1. Protein concentration in the aqueous humor after injection of LPS and rolipram. LPS (100 µg) was injected into the rat footpad. Rolipram dissolved in 3% DMSO or 3% DMSO alone was injected intraperitoneally 30 minutes before LPS. Aqueous samples were aspirated 24 hours after LPS. Data are the mean ± SD (n = 12). *P < 0.05; **P < 0.01.

 


View larger version (13K):
[in this window]
[in a new window]
  		FIGURE 2. Number of cells in the aqueous chamber after injection of LPS and rolipram. Aqueous samples were aspirated 24 hours after LPS injection. Data are the mean ± SD (n = 12). **P < 0.01.

 
Expression of mRNAs for E-selectin, TNF-{alpha}, IL-6, and iNOS after LPS Injection
After injection of LPS into the footpad, mRNAs for E-selectin, TNF-{alpha}, and IL-6 in the iris and ciliary body increased at 1.5 hours, reached maximum levels (88 ± 5-, 62 ± 8-, and 1250 ± 150-fold, respectively) at 3 hours, and then gradually decreased. After injection of LPS into the footpad, iNOS mRNA in the iris and ciliary body increased at 3 hours, reached maximum level (75 ± 11-fold) at 6 hours, and then gradually decreased.

Inhibition of Expression of mRNAs for E-selectin, TNF-{alpha}, IL-6, and iNOS by Rolipram
The levels of mRNAs for E-selectin, TNF-{alpha}, and IL-6 in the iris and ciliary body were determined 3 hours after LPS injection, and iNOS mRNA levels were determined 6 hours after LPS injection. Rolipram inhibited the expression of mRNAs for E-selectin (Fig. 3a) , TNF-{alpha} (Fig. 3b) , and IL-6 (Fig. 3c) in the iris and ciliary body 3 hours after LPS administration in a dose-dependent manner (7.5–30 µmol/kg). The mRNA levels for E-selectin, TNF-{alpha}, and IL-6 in the iris and ciliary body of the rats treated with 30 µmol/kg rolipram and LPS were 31 ± 3-, 10 ± 2-, and 444 ± 70-fold, respectively. Rolipram did not inhibit the expression of iNOS mRNA in the iris and ciliary body 6 hours after LPS administration (Fig. 3d) .



View larger version (24K):
[in this window]
[in a new window]
  		FIGURE 3. Effect of rolipram on mRNA levels in the iris and ciliary body after LPS injection. (a) E-selectin mRNA; (b) TNF-{alpha} mRNA; (c) IL-6 mRNA; (d) iNOS mRNA. LPS (100 µg) was injected into the rat footpad. Rolipram dissolved in 3% DMSO or 3% DMSO alone was injected intraperitoneally 30 minutes before LPS. For determination of E-selectin, TNF-{alpha}, and IL-6 mRNA, the eye globe was enucleated 3 hours after LPS injection, and the iris and ciliary body were prepared. For determination of iNOS mRNA, the eye globe was enucleated 6 hours after administration of LPS. Data are the mean ± SD (n = 12). *P < 0.05; **P < 0.01.

 
Inhibition of Protein Levels of TNF-{alpha} and IL-6 in the Anterior Chamber by Rolipram
After injection of LPS into the footpad, protein levels of TNF-{alpha} and IL-6 in the anterior chamber increased, reached maximum levels (350 ± 30 and 1239 ± 123 pg/mL, respectively) at 4 to 6 hours, and then gradually decreased. Rolipram (30 µmol/kg) decreased TNF-{alpha} (Fig. 4a) and IL-6 (Fig. 4b) (63 ± 7 and 401 ± 43 pg/mL, respectively) in the anterior chamber 4 hours after LPS administration.



View larger version (19K):
[in this window]
[in a new window]
  		FIGURE 4. Effect of rolipram on protein levels of cytokines and nitrite levels in the aqueous humor after LPS injection. (a) TNF-{alpha}; (b) IL-6; and (c) nitrite. LPS (100 µg) was injected into the rat footpad. Rolipram dissolved in 3% DMSO or 3% DMSO alone was injected intraperitoneally 30 minutes before LPS. For determination of TNF-{alpha} and IL-6, aqueous samples were aspirated 4 hours after LPS injection. For determination of nitrite, aqueous samples were aspirated 16 hours after LPS administration. Data are the mean ± SD (n = 12). *P < 0.05; **P < 0.01.

 
Effect of Rolipram on Nitrite Levels in the Aqueous Humor after LPS Injection
After injection of LPS into the footpad, nitrite levels in the aqueous humor increased, reached maximum level (12.65 µM) at 14 to 20 hours, and then gradually decreased. Rolipram did not inhibit nitrite levels in the aqueous humor 16 hours after administration of LPS (Fig. 4c) .

Immunohistochemistry of NF-{kappa}B p-65 in the Iris-Ciliary Body after LPS Injection
After injection of LPS into the footpad, activated NF-{kappa}B p65 immunoreactivity on the nuclear region of cells in iris-ciliary body was strong at 1 hour (Fig. 5) . Weak immunoreactivity was found 4 hours after LPS. One hour after LPS injection, rolipram at 15 and 30 µmol/kg decreased the number of NF-{kappa}B p65-positive cells in the iris-ciliary body.



View larger version (143K):
[in this window]
[in a new window]
  		FIGURE 5. Immunohistochemistry of NF-{kappa}B p65 in the iris-ciliary body of the rat after injection of LPS. (a) NaCl (0.9%) injection. One hour after injection of (b) LPS, (c) LPS and 15 µmol/kg rolipram, or (d) LPS and 30 µmol/kg rolipram. Brown reaction products indicate positive immunoperoxidase localization of NF-{kappa}B p65. Results are representative of four experiments. Light hematoxylin staining; original magnification, x400.

 
Immunohistochemistry of TNF-{alpha} in the Iris-Ciliary Body after LPS Injection
After injection of LPS into the footpad, TNF-{alpha} immunoreactivity was strongly expressed in the iris and ciliary body at 4 hours (Fig. 6) . Weak reactivity was found 12 hours after LPS. Four hours after LPS injection, rolipram at 15 and 30 µmol/kg decreased reactivity.



View larger version (9K):
[in this window]
[in a new window]
  		FIGURE 6. Immunohistochemistry of TNF-{alpha} in the iris-ciliary body of the rat after injection of LPS. (a) NaCl (0.9%) injection. Four hours after injection of (b) LPS, (c) LPS and 15 µmol/kg rolipram, or (d) LPS and 30 µmol/kg rolipram. Fluorescein (arrows) indicates localization of TNF-{alpha}. Results are representative of four experiments. Original magnification, x400.

 

   Discussion
Top
 Abstract
 Materials and Methods
 Results
 Discussion
References
 
In the present study, protein and cells in the anterior chamber increased 18 to 30 hours after 100 µg of LPS was injected. Our findings of LPS-induced anterior uveitis in Wistar rats were similar to those in Lewis and Wistar rats described by Rosenbaum et al.,1 and in young Lewis rats described by Hoekzema et al.2

In our preliminary study, rolipram was injected intraperitoneally 60 or 30 minutes before, at the same time of, or 30 minutes after administration of LPS. Rolipram injected 30 minutes before LPS was most effective in inhibiting LPS-induced elevation of intracameral protein and cells. In our present study, therefore, rolipram was injected 30 minutes before LPS.

Alterations in behavior occurred in some rats treated with rolipram in the present study. The alterations were mild and were observed only in a small number of rats treated with 30-µmol/kg doses. Our findings were similar to those described by Wachtel.25

Hoekzema et al.2 reported that after LPS injection, the IL-6 concentration increased in the aqueous humor of Lewis rats. In a study by de Vos et al.3 TNF-{alpha} and IL-6 levels in the aqueous humor of Lewis rats were elevated 4 hours after administration of LPS. Suzuma et al.4 have reported observing E-selectin immunoreactivity on the vessel walls of the iris 7 hours after LPS treatment in male Lewis rats. Our present findings of LPS-induced expression of mRNAs for E-selectin, TNF-{alpha}, and IL-6 and elevation of TNF-{alpha} and IL-6 in the aqueous humor in Wistar rats were similar to those in Lewis rats described by these investigators.2 3 4 Goureau et al.7 reported that after LPS injection, iNOS mRNA in the iris-ciliary body increased at 2 to 24 hours, and nitrite in the aqueous humor increased in Lewis rats to 18 µM at 16 hours. Increased expression of iNOS mRNA 6 hours after LPS injection and elevated nitrite production 16 hours after LPS injection in our present study were similar. Baeuerle and Henkel11 reported that LPS induces translocation of NF-{kappa}B and mediates the overproduction of TNF-{alpha}. In our present study, NF-{kappa}B immunoreactivity was strong 1 hour after LPS injection. Ollivier et al.26 reported that cAMP inhibited NF-{kappa}B–mediated transcription in human monocytic cells and endothelial cells. Our findings of LPS-induced translocation of NF-{kappa}B and its inhibition by rolipram are compatible with those findings.11 26

Rolipram suppressed several types of inflammation.16 17 18 19 Klemm et al.17 reported that rolipram inhibited endogenous TNF-{alpha} production in a murine model of acute inflammation induced by zymosan. In a study by Buttini et al.18 the level of TNF-{alpha} mRNA induced in rat brain by LPS challenge was reduced by intraperitoneal administration of rolipram. Ross et al.19 have proposed that a major mechanism of action of rolipram in collagen-induced arthritis is suppression of TNF-{alpha} activity. In our present study, rolipram inhibited LPS-induced anterior uveitis and suppressed mRNAs for E-selectin, TNF-{alpha}, and IL-6 and protein levels of TNF-{alpha} and IL-6 in Wistar rats.

Increased NO production has been thought to be involved in LPS-induced uveitis.7 8 9 In our present study, increased nitrite production was found in LPS-induced uveitis. Also, rolipram decreased LPS-induced elevation of protein and cells in the aqueous chamber, did not inhibit the expression of iNOS mRNA, and increased nitrite production induced by LPS. Dutta et al.27 reported that the injection of LPS increased iNOS activity in the lung of Long-Evans rats, but pretreatment with rolipram did not affect NOS activity. Ross et al.19 reported that rolipram inhibited the expression of TNF-{alpha} and IL-12, but did not affect NO production in collagen-induced arthritis in mice. Lieb et al.28 reported that rolipram showed no inhibitory effect on LPS-induced iNOS or NO synthesis. The effects of rolipram on NO production that we observed were similar to those described previously.20 27 28 It is unclear at present whether rolipram is clinically useful in treating uveitis or not.

In conclusion, the findings in our present study indicate that NF-{kappa}B translocation and expression of E-selectin, TNF-{alpha}, and IL-6 were involved in the pathogenesis of LPS-induced uveitis and were inhibited by rolipram. In contrast, the inhibitory effect of rolipram on LPS-induced uveitis was independent of iNOS synthesis and NO production in Wistar rats.


   Footnotes
 
Supported in part by Grant-in-Aid for Scientific Research Grant 14571661 and by 21st Century COE Program from the Ministry of Education, Science, Sports and Culture of Japan.

Submitted for publication December 18, 2003; revised March 1 and March 17, 2004; accepted March 23, 2004.

Disclosure: Z.-L. Chi, None; S. Hayasaka, None; X.-Y. Zhang, None; Y. Hayasaka, None; H.-S. Cui, None

The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact.

Corresponding author: Zai-Long Chi, Department of Ophthalmology, Toyama Medical and Pharmaceutical University, 2630 Sugitani, Toyama 930-0194, Japan; ophthal{at}ms.toyama-mpu.ac.jp.


   References
Top
 Abstract
 Materials and Methods
 Results
 Discussion
 References
 

  1. Rosenbaum JT, McDevitt HO, Guss RB, Egbert PR. Endotoxin-induced uveitis in rats as a model for human disease. Nature. 1980;286:611–613.[CrossRef][Medline][Order article via Infotrieve]
  2. Hoekzema R, Verhagen C, van Haren M, Kijlstra A. Endotoxin-induced uveitis in the rat: the significance of intraocular interleukin-6. Invest Ophthalmol Vis Sci. 1992;33:532–539.[Abstract/Free Full Text]
  3. de Vos AF, van Haren MAC, Verhagen C, Hoekzema R, Kijlstra A. Kinetics of intraocular tumor necrosis factor and interleukin-6 in endotoxin-induced uveitis in the rat. Invest Ophthalmol Vis Sci. 1994;35:1100–1106.[Abstract/Free Full Text]
  4. Suzuma I, Mandai M, Suzuma K, Ishida K, Tojo SJ, Honda Y. Contribution of E-selectin to cellular infiltration during endotoxin-induced uveitis. Invest Ophthalmol Vis Sci. 1998;39:1620–1630.[Abstract/Free Full Text]
  5. Haddad JJ, Land SC, Tarnow-Mordi WO, Zembala M, Kowalczyk D, Lauterbach R. Immunopharmacological potential of selective phosphodiesterase inhibition. Differential regulation of lipopolysaccharide-mediated proinflammatory cytokine (interleukin-6 and tumor necrosis factor-{alpha}) biosynthesis in alveolar epithelial cells. J Pharmacol Exp Ther. 2002;300:559–566.[Abstract/Free Full Text]
  6. Lang CH, Silvis C, Deshpande N, Nystrom G, Frost RA. Endotoxin stimulates in vivo expression of inflammatory cytokines tumor necrosis factor alpha, interleukin-1[beta],-6, and high-mobility-group protein-1 in skeletal muscle. Shock. 2003;19:538–546.[CrossRef][ISI][Medline][Order article via Infotrieve]
  7. Goureau O, Bellot J, Thillaye B, Courtois Y, de Kozak Y. Increased nitric oxide production in endotoxin-induced uveitis: reduction of uveitis by an inhibitor of nitric oxide synthase. J Immunol. 1995;154:6518–6523.[Abstract]
  8. Jacquemin E, de Kozak Y, Thillaye B, Courtois Y, Goureau O. Expression of inducible nitric oxide synthase in the eye from endotoxin-induced uveitis rats. Invest Ophthalmol Vis Sci. 1996;37:1187–1196.[Abstract/Free Full Text]
  9. Ohgami K, Shiratory K, Kotake S, Nishida T, Mizuki N, Yazawa K, Ohno S. Effects of astaxanthin on lipopolysaccharide-induced inflammation in vitro and in vivo. Invest Ophthalmol Vis Sci. 2003;44:2694–2701.[Abstract/Free Full Text]
  10. Nathan CF, Xie F. Regulation of biosynthesis of nitric oxide. J Biol Chem. 1994;269:13725–13728.[Free Full Text]
  11. Baeuerle PA, Henkel T. Function and activation of NF-kappa B in the immune system. Annu Rev Immunol. 1994;12:141–179.[ISI][Medline][Order article via Infotrieve]
  12. Robicsek SA, Blanchard DK, Djeu JY, Krzanowski JJ, Szentivanyi A, Polson JB. Multiple high-affinity cAMP-phosphodiesterases in human T-lymphocytes. Biochem Pharmacol. 1991;42:869–877.[CrossRef][ISI][Medline][Order article via Infotrieve]
  13. Godfrey RW, Manzi RM, Gennaro DE, Haffstein ST. Phospholipid and arachidonic acid metabolism in zymosan-stimulated human monocytes: modulation by cAMP. J Cell Physiol. 1987;131:384–392.[CrossRef][ISI][Medline][Order article via Infotrieve]
  14. Nielson CP, Vestal RE, Sturm RJ, Heaslip R. Effects of selective phosphodiesterase inhibitors on the polymorphonuclear leukocyte respiratory burst. J Allergy Clin Immunol. 1990;86:801–808.[CrossRef][ISI][Medline][Order article via Infotrieve]
  15. Souness JE, Carter CM, Diocee BK, Hassall GA, Wood LJ, Turner NC. Characterization of guinea-pig eosinophil phosphodiesterase activity: assessment of its involvement in regulating superoxide generation. Biochem Pharmacol. 1991;42:937–945.[CrossRef][ISI][Medline][Order article via Infotrieve]
  16. Teixeira MM, Rossi AG, Williams TJ, Hellewell PG. Effects of phosphodiesterase isoenzyme inhibitors on cutaneous inflammation in the guinea-pig. Br J Pharmacol. 1994;112:332–340.[ISI][Medline][Order article via Infotrieve]
  17. Klemm P, Harris HJ, Perretti M. Effect of rolipram in a murine model of acute inflammation: comparison with the corticoid dexamethasone. Eur J Pharmacol. 1995;281:69–74.[CrossRef][ISI][Medline][Order article via Infotrieve]
  18. Buttini M, Mir A, Appel K, et al. Lipopolysaccharide induces expression of tumor necrosis factor alpha in rat brain: inhibition by methylprednisolone and by rolipram. Br J Pharmacol. 1997;122:1483–1489.[CrossRef][ISI][Medline][Order article via Infotrieve]
  19. Ross SE, Williams RO, Mason LJ, et al. Suppression of TNF-{alpha} expression, inhibition of Th1 activity, and amelioration of collagen-induced arthritis by rolipram. J Immunol. 1997;159:6253–6259.[Abstract]
  20. Xu H, Strassmann G, Chan CC, et al. Protective effect of the type 4 phosphodiesterase inhibitor rolipram in EAU: protection is independent of IL-10-inducing activity. Invest Ophthalmol Vis Sci. 1999;40:942–950.[Abstract/Free Full Text]
  21. Blease K, Burke-Gaffney A, Hellewell PG. Modulation of cell adhesion molecule expression and function on human lung microvascular endothelial cell by inhibition of phosphodiesterase 3 and 4. Br J Pharmacol. 1998;124:229–237.[CrossRef][ISI][Medline][Order article via Infotrieve]
  22. Sanz MJ, Alvarez A, Piqueras L, et al. Rolipram inhibits leukocyte-endothelial cell interaction in vivo through P- and E-selectin downregulation. Br J Pharmacol. 2002;135:1872–1881.[CrossRef][ISI][Medline][Order article via Infotrieve]
  23. Bodon D, Breulet M, Gerard-Vandenhove MA, et al. Is phosphodiesterase inhibition a new mechanism of antidepressant action?—a double blind double-dummy study between rolipram and desipramine in hospitalized major and/or endogenous depressives. Eur Arch Psychiatry Neurol Sci. 1988;238:2–6.[CrossRef][Medline][Order article via Infotrieve]
  24. Bradford MM. A rapid and sensitive method for quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 1976;72:248–254.[CrossRef][ISI][Medline][Order article via Infotrieve]
  25. Wachtel H. Characteristic behavioral alterations in rats induced by rolipram and other selective adenosine cyclic 3',5'-monophosphate phosphodiesterase inhibitors. Psychopharmacology. 1982;77:309–316.[CrossRef][Medline][Order article via Infotrieve]
  26. Ollivier V, Parry GCN, Cobb RR, de Prost D, Mackman N. Elevated cyclic AMP inhibits NF-kb-mediated transcription in human monocytic cells and endothelial cells. J Biol Chem. 1996;271:20828–20835.[Abstract/Free Full Text]
  27. Dutta P, Ryan DE, Tabrizchi R. The influence of phosphodiesterase inhibitor, rolipram, on hemodynamics in lipopolisaccharide-treated rats. Jpn J Pharmacol. 2001;85:241–249.[CrossRef][Medline][Order article via Infotrieve]
  28. Lieb K, Engels S, Fiebich BL. Inhibition of LPS-induced iNOS and NO synthesis in primary rat microglial cells. Neurochem Int. 2003;42:131–137.[CrossRef][ISI][Medline][Order article via Infotrieve]



This article has been cited by other articles:


Home page
 J. Immunol.Home page
R. Herve, T. Schmitz, D. Evain-Brion, D. Cabrol, M.-J. Leroy, and C. Mehats
The PDE4 Inhibitor Rolipram Prevents NF-{kappa}B Binding Activity and Proinflammatory Cytokine Release in Human Chorionic Cells
J. Immunol., August 1, 2008; 181(3): 2196 - 2202.
[Abstract] [Full Text] [PDF]

Home page
 IOVSHome page
Z.-L. Chi, S. Hayasaka, X.-Y. Zhang, H.-S. Cui, and Y. Hayasaka
A Cholinergic Agonist Attenuates Endotoxin-Induced Uveitis in Rats
Invest. Ophthalmol. Vis. Sci., June 1, 2007; 48(6): 2719 - 2725.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
T. Schmitz, E. Souil, R. Herve, C. Nicco, F. Batteux, G. Germain, D. Cabrol, D. Evain-Brion, M.-J. Leroy, and C. Mehats
PDE4 Inhibition Prevents Preterm Delivery Induced by an Intrauterine Inflammation
J. Immunol., January 15, 2007; 178(2): 1115 - 1121.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Pharmacol.Home page
M. E. Sayah, R. Medeiros, E. S. Fernandes, M. M. Campos, and J. B. Calixto
Mechanisms Underlying Lipopolysaccharide-Induced Kinin B1 Receptor Up-Regulation in the Pig Iris Sphincter in Vitro
Mol. Pharmacol., May 1, 2006; 69(5): 1701 - 1708.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a response
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chi, Z.-L.
Right arrow Articles by Cui, H.-S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chi, Z.-L.
Right arrow Articles by Cui, H.-S.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS