|
|
||||||||
From the Department of Biochemistry and Molecular Biology, University of Texas Medical Branch, Galveston, Texas.
| Abstract |
|---|
|
|
|---|
Bdependent signals in human lens epithelial cells (HLECs).
METHODS. Growth-arrested HLECs were cultured without or with AR inhibitors or transfected with an AR small interfering (si)RNA. Subsequently, the cells were stimulated with LPS (1-10 µg/mL) for 24 hours. The cell viability was assessed by cell counts and MTT assay, and apoptosis was measured by nucleosomal degradation. Electrophoretic mobility gel shift assays were performed to determine the activation of NF-
B and AP1. The levels of nitric oxide, MMP-2, MMP-9, Cox-2, and TNF-
were measured by using specific ELISA kits. Western blot analysis was performed to determine the cleavage of poly(ADP-ribose) polymerase (PARP) and the activation of PKC and mitogen-activated protein kinase (MAPK).
RESULTS. Bacterial LPS caused apoptosis of HLECs. Inhibition of AR by two structurally unrelated inhibitors, sorbinil and tolrestat, or ablation by AR siRNA prevented the LPS-induced apoptosis, activation of caspase-3 and cleavage of PARP protein. Inhibition of AR in HLECs also prevented the LPS-induced activation of redox-sensitive transcription factors such as NF-
B and AP1 and their downstream signals that lead to expression of Cox-2, MMP-2, MMP-9, and TNF-
proteins. In addition, inhibition of AR prevented LPS-induced activation of protein kinases upstream to NF-
B activation such as PKC and MAPK in HLECs.
CONCLUSIONS. The results indicate that AR mediates the bacterial endotoxin signaling that could damage HLECs by regulating the signals that activate the redox-sensitive transcription factor NF-
B and cause inflammation. Thus, inhibition of AR could be a therapeutic target for Gram-negative bacterial infectioninduced visual complications.
, IL-1, IL-6, and IFN-
.8 9 10 At low concentrations, the cytokines trigger a variety of host responses that eliminate invading bacteria; however, at overwhelming concentrations, they can induce significant morbidity due to the increase in oxidative stress and the reactive oxygen species (ROS)mediated increase in NF-
B that could cause an inflammatory response leading to septic shock marked by high fever and severe inflammatory reactions.8 11 12 The eye can also be exposed to various cytokines and chemokines generated locally as well as peripherally that are released as a result of infection.13 14 Particularly, the lens can also be exposed to various inflammatory mediators that on bacterial infections are present in the aqueous humor.15 16 17 In fact, we and others have shown that incubation of HLECs with cytokines such as TNF-
increases the activation of NF-
B and cause cytotoxicity.18 19
NF-
B is a redox sensitive transcription factor comprising p65 (RelA) and p50 subunits.20 Under normal conditions, it is present in the cytoplasm and is sequestered by the inhibitory protein I
B, which renders it inactive. Various stress conditions activate NF-
B by initiating phosphorylation and the dissociation of I
B-
, permitting the translocation of the active NF-
B dimer to the nucleus where it can bind to its cognitive elements in the target genes involved in cytotoxicity.20 21 Recently, we have shown that aldose reductase (AR) mediates cytokine-induced activation of NF-
B in various cells.19 22 23 24 25
AR, a member of the aldo-keto reductase superfamily, is a rate-limiting enzyme of the polyol pathway of glucose metabolism that converts glucose to sorbitol in the presence of NADPH (reduced nicotinamide adenine dinucleotide phosphate). AR is expressed in all the ocular tissues, and its activity in all the human tissues studied has been shown to increase during hyperglycemia and other oxidative stress response diseases.26 27 Therefore, AR has been implicated in the pathophysiology of diabetic complications. We have recently shown that inhibition of AR prevents oxidative stressinduced and cytokine or hyperglycemia-initiated cell signals leading to proliferation of vascular smooth muscle cells and apoptosis of vascular endothelial cells and HLECs.19 22 23 24 We have further shown that AR inhibition or ablation prevents the activation of PKC/NF-
B signals that cause cytotoxicity.22 23 24 Although there has been significant progress in understanding LPS-induced oxidative stress signals in monocytes, macrophages, and leukocytes, little is currently known about LPS responses in nonimmune cells such as lens epithelial cells. Therefore, in the present study, we have investigated the effect of AR inhibition/ablation on LPS-induced cytotoxic signals in HLECs, leading to activation of NF-
B and inflammation. Our results show that inhibition or ablation of AR prevents LPS-induced activation of NF-
B and production of inflammatory markers such as nitric oxide, PGE2, Cox-2, TNF-
, MMP-2, and MMP-9.
| Materials and Methods |
|---|
|
|
|---|
B (5'-AGTTGAGGGGACTTTCCCAGGC-3') and AP1 (5'-CGCTTGATGAGTCAGCCGGAA-3') transcription factors from Promega Corp. (Madison, WI); nitrite/nitrate, Cox-2 and PGE-2 assay kits from Cayman Chemical Inc. (Ann Arbor, MI); and a human TNF-
ELISA kit from BD Biosciences (San Diego, CA). 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) and other reagents used in the electrophoretic mobility gel shift assay (EMSA) and Western blot analysis were obtained from Sigma-Aldrich (St. Louis, MO). All other reagents used were of analytical grade.
Cell Culture
The HLEC line B3 was obtained from American Type Culture Collection (catalog no., CRL-11421). This cell line (transfected with Ad12-SV-40 virus) was derived from human lens obtained within 24 hours from 5- to 1-month-old patient of retinopathy and characterized by their ability to synthesize ß- and
-crystallins as monitored by immunoblot analysis. The cells were grown in MEM with 20% fetal bovine serum at 37°C in a 5% CO2 humidified atmosphere. To investigate the effect of LPS on NF-
B signals, we cultured the serum-starved HLECs in the medium containing 1 µg LPS/mL because in 24 hours, this concentration of LPS did not cause measurable apoptosis but was sufficient to activate the signaling pathways that induce the expression of inflammatory proteins. However, for significant (50%60%) apoptosis, 5 µg LPS/mL culture medium was necessary. In view of this, in all the apoptosis experiments, we used 5 µg/mL of LPS and in NF-
B signaling experiments, 1 µg/mL.
RNA Interference Ablation of AR in HLECs
The ablation of AR mRNA was performed essentially as described earlier.22 Briefly, HLECs were incubated with serum-free medium containing the AR-small interfering (si)RNA (AACGCATTGCTGAGAACTTTA) or scrambled siRNA (AACACGGCTTGAATGACTATA; control) to a final concentration of 100 nM with transfection reagent (RNAiFect; Qiagen, Chatsworth, CA). After 15 minutes of incubation at 25°C, the medium was aspirated and replaced with fresh MEM containing 10% serum. The cells were cultured for 48 hours at 37°C, and AR expression was determined by measuring AR protein by Western blot analysis using anti-AR antibodies and by measuring AR activity in the total cell lysates.25
Cell Viability Assays
The cells were grown to confluence in MEM, harvested by trypsinization, and plated at 5000 cells/well in a 96-well plate. The cells were growth arrested for 24 hours by replacing fresh medium containing 0.5% FBS and 50 µg/mL of gentamicin. The low serum levels were maintained during growth arrest to prevent the slow apoptosis that accompanies complete serum deprivation in the cell lines. After 24 hours, LPS (110 µg/mL), without or with ARI (10 µM), was added to the medium, and the cells were incubated for an additional 24 hours. Cell viability was detected by the MTT assay, in which the MTT is converted into formazan granules in the presence of molecular oxygen. After the incubation, 10 µL of 5 mg/mL MTT was added to each well of the 96-well plates and incubated at 37°C for 2 hours. The formazan granules obtained were dissolved in 100% dimethyl sulfoxide (DMSO), and absorbance at 562 nm was detected with a 96-well ELISA reader. The cell viability was also calculated by cell counting with a hemocytometer. Briefly, the cells were harvested by trypsinization, washed with PBS, and mixed with an equal amount of trypan blue dye. The percentage of the cells excluding trypan blue was calculated. At least four individual measurements were used for each treatment for statistical analysis.
Determination of Apoptosis
Apoptosis was evaluated by using a cell deathdetection ELISA kit (Roche Inc., Indianapolis, IN) that measures cytoplasmic DNAhistone complexes generated during apoptotic DNA fragmentation. Cell death detection was performed according to the manufacturers instructions and monitored spectrophotometrically at 405 nm. LPS (5 µg/mL)-induced apoptosis was also analyzed by using nuclear staining with Hoechst 33342, a DNA-binding fluorescent dye. Briefly, after various treatments, the HLECs were incubated with 5 µg/mL of Hoechst 33342 for 30 minutes at 4°C. The morphologic characteristics of apoptotic cells were identified with the aid of a fluorescence microscope (Eclipse E800; Nikon, Tokyo, Japan), with excitation at 540 nm. The cells with fragmented and/or condensed nuclei were classified as apoptotic cells.
Caspase-3 Activity
The activity of caspase-3 was measured by using the specific caspase-3 substrate Z-DEVD-AFC (CBZ-Asp-Glu-Val-Asp-AFC) which was incubated with cell lysate and the fluorescence (excitation, 400 nm; emission 505 nm) released by the cleavage of substrate was measured by using a 96-well fluorescence plate reader. The in situ activation of caspase-3 was also measured by using cleavage of poly-(ADP-ribose)-polymerase (PARP) by activated caspase-3 in LPS-induced cells in the absence and presence of AR inhibitors (ARIs), by performing Western blot analysis.
Cell Cycle Analysis
The cells were grown to confluence in MEM, harvested by trypsinization, and plated at 100,000 cells/well in six-well plates. The cells were growth arrested for 24 hours by replacing fresh medium containing 0.5% FBS and 50 µg/mL of gentamicin. After 24 hours, LPS (5 µg/mL) without or with ARIs (10 µM) was added to the medium, and the cells were incubated for an additional 24 hours. Cells were harvested, washed, and fixed in 70% chilled ethanol for 2 hours followed by staining with propidium iodide (50 µg/mL) for 20 minutes. Cell cycle analysis was performed by flow cytometry (FACSCanto; BD Biosciences).
EMSAs for NF-
B and AP1
The cells were pretreated with ARIs for 24 hours and then with LPS (1 µg/mL) for 2 hours at 37°C. The cytosolic as well as nuclear extracts were prepared and electrophoretic mobility gel shift assays (EMSAs) were performed as described earlier.22 Briefly, nuclear extracts prepared from various control and treated cells were incubated with oligonucleotides for NF-
B or AP1 for 15 minutes at 37°C, and the DNA-protein complex formed was resolved on 6.5% native polyacrylamide gels. The specificity of the binding was also examined by competition with excess of unlabeled oligonucleotide. Supershift assays were also performed to determine the specificity of NF-
B binding to its specific consensus sequence by using specific antibodies to p65.
Prostaglandin E2 Assay
HLECs were plated in 6-well plates at a density of 1 x 105 cells/well. After 24 hours, the medium was replaced with serum-free medium with or without ARIs (10 µM). The growth-arrested cells were treated with 1 µg/mL of LPS for another 24 hours. The medium was collected from each well and analyzed for PGE2 by using an EIA kit according to the manufacturers instructions (Cayman Chemical Co., Inc.). Briefly, 50 µL of diluted standard/sample was pipetted into a 96-well plate precoated with goat polyclonal anti-mouse IgG. Aliquots (50 µL) of a PGE2 monoclonal antibody and PGE2 acetylcholine esterase (AChE) conjugate, (PGE2 tracer) were added to each well and allowed to incubate at 4°C for 24 hours. After incubation, the wells were washed five times with wash buffer containing 0.05% Tween 20, followed by the addition of 200 µL of Ellmans reagent containing acetylthiocholine and 5,5'-dithio-bis-(2-nitrobenzoic acid). Wells were read after 60 minutes at 412 nm with an ELISA reader.
Cox Activity Assay
After various treatments, the HLECs were harvested and homogenized in cold buffer containing 0.1 M Tris-HCl (pH 7.8) and 1 mM EDTA, and the activity was measured in a 96-well plate, according to the manufacturers instructions (Cayman Chemical Co., Inc.). Briefly, 10 µL of standard and sample was incubated in the presence of arachidonic acid and a colorimetric substrate, N, N, N, N-tetra methyl-p-phenylenediamine (TMPD), in a total reaction volume of 210 µL. The Cox-2 peroxidase activity was measured colorimetrically by monitoring the appearance of oxidized TMPD at 590 nm with an ELISA reader.
Matrix Metalloproteinase Assays
Levels of MMP-9 and -2 were measured in the culture medium by using an MMP-2 and -9 activity assay system (Biotrak; GE Healthcare, Piscataway, NJ). Parallel measurements of standards and samples were performed by applying them to an antibody-precoated microplate, and the procedure was followed as indicated by the manufacturers protocol. The absorbance of the samples was determined at 450 nm using a microplate reader. MMP-9 and -2 concentrations were determined from the best linear curve drawn with the absorbance of standards versus their concentrations.
Western Blot Analysis
Western blot analyses were performed with antibodies against PARP and phospho-P38, P38, phospho-JNK, JNK, and AR. Transfected and untransfected HLECs were either untreated or pretreated with tolrestat or sorbinil for 24 hours and then stimulated with 1 µg/mL of LPS for different durations of exposure. Equal amounts of protein were subjected to Western blot analysis using different antibodies, and the antigen-antibody complexes were detected by enhanced chemiluminescence (Pierce, Rockford, IL).
Determination of PKC Activity
The membrane-bound PKC activity was determined as described earlier using a total PKC assay system (SignaTect; Promega).25 Briefly, aliquots of the reaction mixture (25 mM Tris-HCl [pH 7.5] 1.6 mg/mL phosphatidylserine, 0.16 mg/mL diacylglycerol, and 50 mM MgCl2) were mixed with [
-32P]-ATP (3000 Ci/mmol, 10 µCi/µL) and incubated at 30°C for 10 minutes. The extent of phosphorylation was detected by measuring the radioactivity retained on the paper.
Statistical Analysis
Data are presented as the mean ± SEM, and the probabilities were determined with the unpaired Students t-test (P < 0.05 considered as statistically significant).
| Results |
|---|
|
|
|---|
|
|
|
|
Effect of AR Inhibition on LPS-Induced Production of Inflammatory Markers in HLECs
Because the autocrine and paracrine effects of inflammatory cytokines and chemokines produced by LPS are responsible for the propagation of LPS-toxicity,6 7 8 9 we next examined the effect of AR inhibition on the LPS-induced inflammatory markers. As shown in Figures 5A and 5B , treatment of HLECs with 1 µg/mL LPS for 24 hours caused 4.5- and 5-fold increases in the synthesis of PGE2 and activation of Cox, respectively, and inhibition of AR significantly (>80%) prevented these changes. An eightfold increase in the LPS-induced nitrite/nitrate levels in HLECs was also significantly (>75%) prevented by AR inhibition (Fig. 5C) . Similarly LPS caused a nearly 20-fold increase in TNF-
in the HLEC culture medium and sorbinil or tolrestat inhibited the increase by >85% (Fig. 5D) . Furthermore, LPS caused
120% and
45% increases in the levels of HLEC MMP-2 and -9, respectively, and inhibition of AR significantly (60%70%) prevented the increase (Fig. 6) .
|
|
B and AP1 in HLECs
B and AP1 are responsible for the transcription of various inflammatory markers,20 21 we next examined the effect of AR inhibition on LPS-induced activation of NF-
B and AP1. As shown in Figure 7A , LPS caused profound activation of NF-
B, and sorbinil and tolrestat significantly (>60%) prevented the LPS-induced NF-
B activity. Sorbinil or tolrestat alone did not affect the basal NF-
B activity in the HLECs. Further, AR inhibition also prevented LPS-induced activation of AP1 (Fig. 7B) . These results suggest that by modulating the LPS-induced activation of redox-sensitive transcription factors, ARIs could prevent LPS-induced production of inflammatory markers and cytotoxicity.
|
B activation,29 30 we next examined the effect of AR inhibition on LPS-induced activation of PKC and MAPKs. As shown in Figure 8A , LPS caused
3-fold activation of membrane-bound PKC in HLECs, and inhibition of AR significantly (>85%) prevented it. However, sorbinil or tolrestat by itself did not alter the total PKC activity in these cells. The phosphorylated forms of p38, MAPK, and JNK were markedly enhanced in HLECs stimulated with LPS, but there was no change in the expression of total JNK and p38 MAPK. Inhibition of AR prevented LPS-induced phosphorylation of p38 and JNK but not their protein synthesis in HLECs (Figs. 8B 8C 8D 8E) . Collectively, these results suggest that inhibition of AR in HLECs prevents PKC activation by interrupting upstream signaling of the NF-
B induced by LPS.
|
| Discussion |
|---|
|
|
|---|
B, which regulates the expression of a variety of genes essential for cellular immune response, inflammation, growth, development, and apoptotic processes.12 During Gram-negative bacterial infections, excessive cytokines and chemokines are generated that, in an autocrine and paracrine manner, cause tissue damage that leads to multiorgan failure and septic shock.6 7 8 9 In general, the ocular tissues are exposed to various cytokines and other proinflammatory markers that are released as a result of injury, infection, and/or disease processes.1 2 3 Even though the lens is located within the very center of the eye, it can also be exposed to various inflammatory markers present in the aqueous humor subsequent to bacterial infection, and the lens epithelium has also been shown to produce cytokines.14 15 16
Herein, we have presented several lines of experimental evidence to suggest that LPS predominantly induces apoptosis in HLECs that can be inhibited by either pharmacological inhibition of AR or by using RNA interference ablation of the AR message. Our studies suggest that the salutary effects of AR inhibition may be related to inhibition of inflammatory signaling mediated by transcription factors (NF-
B and AP-1) and stress-activated MAPKs (JNK and p38).
Recent investigations have also shown the involvement of various caspases and cytokines associated with the decline in lens clarity.31 32 33 34 Alexander et al.34 have shown the activation of LPS-induced NF-
B in the mouse lens, whereas Dudek et al.35 have shown the activation of NF-
B by TNF-
in HLECs. Moreover, our earlier studies have suggested that TNF-
causes activation of NF-
B and apoptosis in HLECs.19 However, the apoptosis of HLECs as a causative factor of cataractogenesis is controversial. Recently, it has been shown that lens epithelial cell apoptosis is an initiating factor in noncongenital cataract formation,36 37 whereas Harocopos et al.,38 have shown that apoptosis of HLECs is not the major cause of age-related cataract formation. In contrast, Li et al.39 and others40 have shown that exposure of rat lens to hydrogen peroxide causes lens epithelial cell death followed by lens opacification. Further, oxidative stress caused by various stimulants such as infections, UVB radiation, and environmental contaminants could cause HLEC apoptosis that leads to the opacification of the rat lens.40 41 Andley et al.,42 have shown that increased biosynthesis of PGE2 may be important in formation of posterior subcapsular cataracts in humans and in animals exposed to UVB radiation.
A general role of AR in mediating inflammation and cytokine generation is consistent with our observations showing that inhibition of AR prevents PKC and NF-
B activation by a variety of stimuli, such as TNF-
, FGF, PDGF, angiotensin-II, and high glucose25 43 44 and hyperglycemia-induced MAPK45 and JAK2.46 These findings suggest that AR could be an obligatory mediator of stress response including the activation of NF-
B and other PKC-sensitive transcription factors. Activation of NF-
B requires association of IKK (Inhibitor of kappaB kinase)-
, IKKß, and IKK
.47 In LPS signaling, the IKK
/ß complex is assembled through a TAK1-dependent pathway that also activates JNK and p38.48 The observation that phosphorylation of both the JNK and p38 kinases in the HLECs was severely attenuated by AR inhibition (Figs. 3C 8B) further suggests that the signals preceding TAK1 activation are prevented by ARIs and that the inhibition of AR does not directly interfere with the NF-
B and its downstream effectors. LPS-triggered signaling events further upstream to IKK activation are mediated by the activation of PKC, because macrophage PKC activity is increased by LPS stimulation, and PKC inhibitors prevent LPS-induced NF-
B activation and the release of cytokines.49 50 In agreement with a central role of PKC, we found a marked PKC activation with LPS (Fig. 8A) . AR inhibition or ablation prevented LPS-induced activation of PKC, supporting our previous observation that inhibition of AR prevents PKC activation and thus modulates the activity of NF-
B. Although the mechanisms by which AR facilitates PKC activation remains unclear, we propose that inhibition of AR prevents the events that could lead to the activation of PLC isozymes, which are activated by LPS, as observed in high-glucosetreated vascular smooth muscle cells (VSMCs).43 Recently, we have reported that ARIs prevent phosphatidylinositol-specific phospholipase C (PI-PLC)dependent synthesis of diacylglycerol in high-glucosestimulated VSMCs.43 A similar mechanism could account for the AR mediation of LPS-induced PKC and NF-
B activation in HLECs. Alternatively, AR inhibition could affect signaling due to products of lipid peroxidation or their glutathione conjugates.51 Recent studies have shown that the oxidized phospholipids such as 1-palmitoyl, 2-oxovaleryl phosphocholine (POVPC), which is also a substrate of AR,52 inhibit NF-
B activation and increase mortality in mice injected with lethal doses of LPS.53 This indicates that the inhibition of AR could prevent activation of NF-
B by allowing oxidized phospholipids to accumulate in the cells.
In summary, our current results provide evidence of an unanticipated role of an aldehyde-metabolizing enzyme, AR, in mediating acute inflammatory responses and provide a novel concept that inhibition of AR could be therapeutically useful in preventing ocular tissue inflammation induced by Gram-negative bacterial infections.
| Footnotes |
|---|
Submitted for publication April 25, 2006; revised June 29, July 27, and August 14, 2006; accepted October 5, 2006.
Disclosure: A. Pladzyk, None; A.B.M. Reddy, None; U.C.S. Yadav, None; R. Tammali, None; K.V. Ramana, None; S.K. Srivastava, None
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C.
1734 solely to indicate this fact.
Corresponding author: Satish K. Srivastava, Department of Biochemistry and Molecular Biology, University of Texas Medical Branch, Galveston, TX 77555-0647; ssrivast{at}utmb.edu.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
W. Zou, B. O. Kim, B. Y. Zhou, Y. Liu, A. Messing, and J. J. He Protection against Human Immunodeficiency Virus Type 1 Tat Neurotoxicity by Ginkgo biloba Extract EGb 761 Involving Glial Fibrillary Acidic Protein Am. J. Pathol., December 1, 2007; 171(6): 1923 - 1935. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. C. S. Yadav, S. K. Srivastava, and K. V. Ramana Aldose Reductase Inhibition Prevents Endotoxin-Induced Uveitis in Rats Invest. Ophthalmol. Vis. Sci., October 1, 2007; 48(10): 4634 - 4642. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||