|
|
||||||||
From 1Physiopathological Optics, Department of Biopathology and Diagnostic Imaging, and the 5Department of Experimental Medicine and Biochemical Sciences, University of Rome Tor Vergata, Rome, Italy; 2IRCCS (Istituti di Ricovero e Cura a Carattere Scientifico) Neurological Institute, C. Mondino Foundation, Mondino-Tor Vergata Center for Experimental Neuropharmacology, Laboratory of Neurochemistry, Rome, Italy; the 3Department of Biomedical Sciences, University of Teramo, Teramo, Italy; the 4Department of Pharmacobiology and University Centre for Adaptive Disorders and Headache (UCHAD), Section of Neuropharmacology of Normal and Pathological Plasticity, University of Calabria, Rende, Italy; and the 6Department of Pharmacobiological Sciences, Faculty of Pharmacy, University of Catanzaro "Magna Graecia," Catanzaro, Italy.
| Abstract |
|---|
|
|
|---|
METHODS. Anandamide (AEA) synthesis, transport, hydrolysis, and AEA endogenous levels were assessed by means of high-performance liquid chromatography in the retinas of rats undergoing 45 minutes of ischemia followed by 12 hours of reperfusion. Under these experimental conditions, binding to cannabinoid (CB1R) and vanilloid (TRPV1) receptor was assessed with rapid-filtration assays. AEA-hydrolase (FAAH, fatty acid amide hydrolase), CB1R and TRPV1 protein content was determined by enzyme-linked immunosorbent assay. Finally, to characterize the neuroprotective profile of drugs that interfere with the endocannabinoid system, cell counting in the retinal ganglion cell (RGC) layer and real-time polymerase chain reactions for Thy-1 mRNA expression were used.
RESULTS. In rat retina, ischemic insult followed by reperfusion resulted in enhanced FAAH activity and protein expression paralleled by a significant decrease in the endogenous AEA tone, whereas the AEA-membrane transporter or the AEA-synthase NAPE-PLD (N-acyl-phosphatidylethanolamine-hydrolyzing-phospholipase-D) were not affected. Retinal ischemia-reperfusion decreased the expression of cannabinoid (CB1) and vanilloid (TRPV1) receptors. Systemic administration of a specific FAAH inhibitor (e.g., URB597) reduced enzyme activity and minimized the retinal damage observed in ischemicreperfused samples. Similarly, intravitreal injection of the AEA stable analogue, R(+)-methanandamide, reduced cell loss in the RGC layer, and this was prevented by systemic administration of a CB1 or TRPV1 selective antagonist (e.g., SR141716 and capsazepine, respectively).
CONCLUSIONS. The original observation that retinal ischemia-reperfusion reduces endogenous AEA via enhanced expression of FAAH supports the deduction that this is implicated in retinal cell loss caused by high IOP in the RGC layer.
9-tetrahydrocannabinol (THC), the main psychoactive compound of hashish and marijuana.4 In addition AEA can also activate type 1 vanilloid receptor (now called transient receptor potential vanilloid type 1, TRPV1), which is the target for capsaicin, the pungent ingredient in hot peppers.5 The effects of AEA via CB1 and CB2 receptors depend on its extracellular concentration, which is controlled by cellular uptake via a purported AEA membrane transporter (AMT),6 7 followed by intracellular hydrolysis to arachidonic acid (AA) and ethanolamine by fatty acid amide hydrolase (FAAH).8 9 In contrast, the N-acyl-phosphatidylethanolamine-hydrolyzing phospholipase-D (NAPE-PLD)10 represents a key factor in AEA synthesis.11 12 AEA and its congeners, along with the proteins that bind, transport, synthesize, and degrade these lipids, form the endocannabinoid system.2 13 Shortly after the discovery of AEA,14 its value as a topically applied agent for reducing intraocular pressure (IOP) was reported.15 Since then, the presence of a functional endocannabinoid system in the eye has been widely documented. In fact, porcine ocular tissues synthesize and degrade AEA,16 as do bovine17 and rat retina18 and various human eye tissues.19 In addition, CB1 receptors, FAAH, and TRPV1 have been shown to be widespread in the retina of rats and other mammals by immunocytochemical methods.20 21 The presence of a functional endocannabinoid system in the eye supports a role for endocannabinoids in ocular physiology. In keeping with this concept, endocannabinoids have been shown to possess protective activity in an experimental model of allergic uveitis22 and to regulate photoreception and neurotransmission in the retina.23 24 In particular, several studies have shown that topical administration of CB1 agonists lowers IOP in rabbits, nonhuman primates, and glaucomatous humans,15 25 26 27 28 possibly due to an increase in aqueous humor outflow.28 29 More recently, plant-derived and synthetic cannabinoids have been shown to exert neuroprotective actions in the eye, with potential implications for the treatment of glaucoma.30 In this context, experimental evidence has accumulated in the past few years to support a dual role for AEA in the central nervous system (CNS), as either a neuroprotective or a neurotoxic agent in different paradigms of excitotoxicity and brain ischemia.31 32 It should be recalled that high IOPinduced ischemia is a valuable animal model for studying retinal ischemia,33 34 and that, in this model, preferential damage occurs at the level of the retinal ganglion cell (RGC) layer, similarly to that reported in human glaucoma.35 Therefore, IOP-induced retinal ischemia also represents a relevant model of acute glaucoma. On this basis, the purpose of the present study was to evaluate whether modifications of the endocannabinoid system may be associated with retinal ischemia induced by high IOP, and to ascertain whether drugs that interfere with the endocannabinoid system may prevent retinal damage due to the ischemic insult.
| Materials and Methods |
|---|
|
|
|---|
Drug Treatment
Rats sustaining an ischemic insult in the right eye and a sham procedure in the contralateral eye were divided into five groups and treated as follows, by an investigator blinded to treatment: group 1 served was the control; group 2 received URB597 (3'-carbamoyl-biphenyl-3-yl ester; Alexis Biochemicals, San Diego, CA), a specific FAAH inhibitor,36 (0.3 mg/kg) 1 hour before ischemia; group 3 received an intravitreal injection of MetAEA (R(+)-methanandamide, Calbiochem, San Diego, CA), a stable analog of AEA,37 (5 µL of 1 mM MetAEA dissolved in phosphate-buffered saline, PBS) 30 minutes before ischemia; group 4 was treated with SR141716 (N-piperidino-5-(4-chlorophenyl)-1-(2,4-dichlorophenyl)-4-methyl-3-pyrazole carboxamide; Sanofi-Aventis Recherche, Montpellier, France), a selective CB1 receptor antagonist,38 (3 mg/kg) and after 1 hour was subjected to the same treatment as in group 3; group 5 was injected with capsazepine (N-[2-(4-chlorophenyl) ethyl]-1,3,4,5-tetrahydro-7,8-dihydroxy-2H-2-benzazepine-2-carbothioamide; Sigma-Aldrich Co., St. Louis, MO), a TRPV1-selective antagonist,39 (10 mg/kg), and after 1 hour was subjected to the same treatment as group 3. Drugs administered by intraperitoneal (IP) injection were dissolved in vegetable oil.
Histopathology
After reperfusion, the animals were anesthetized (chloral hydrate, 400 mg/kg IP) and perfused through the left ventricle of the heart with 50 mL of heparinized PBS (pH 7.4), followed by 50 mL of 4% paraformaldehyde in PBS (n = 6 per group). Two hours after perfusion-fixation procedure had been completed, the eyes were enucleated and postfixed in 4% paraformaldehyde for 72 hours. Serial coronal sections, cut along the vertical meridian of the eye passing through the optic nerve head, were stained with hematoxylin and eosin. The number of cells in the RGC layer was counted in six areas (25 µm2 each) of each section (n =5 per eye), at a distance of 300 µm from the optic nerve head on the superior and inferior hemisphere, under a light microscope (40x magnification).
Real-Time PCR Assay
Total RNA was extracted from control and treated retinas of each rat (RNAeasy mini kit; Qiagen, Crawley, UK). One microgram of extracted RNA was used for reverse transcription reaction (total 20 µL; InPromII kit; Promega, Madison, WI). Four microliters of cDNA mix were then used for the PCR amplification. Real-time PCR was performed (Platinum SYBR Green qPCR SuperMix UDG with Rox 50 nM; Invitrogen, Carlsbad, CA) with the following amplification program: one cycle of 95°C for 3 minutes and 40 cycles of 94°C for 15 seconds and 59°C for 50 seconds. The reaction was followed by a melting curve protocol according the specification of the ABI 7500 instrument (Applied Biosystems, Inc., Foster City, CA). The primers used were: CGCTTTATCAAGGTCCTTACTC (Thy1+ [forward]) GTTTTGAGATATTTGAAGGT (Thy1 [reverse]); 5'-GAACCGCTCATTGCCGATAGTG- 3' (ß-actin+) and 5'-TTGTCCCTGTATGCCTCTGGT CG3' (ß-actin). Relative quantitation (comparative method) was performed using as the endogenous control the ß-actin gene transcript. This process allows the normalization quantitation of a messenger RNA (mRNA) target (Ct) for differences in the amount of total RNA added to each reaction (
Ct). The relative value of Thy1 expression has been calculated as the change (x-fold) over control with respect to the calibrator (
Ct), represented by the control retina. Relative quantitation of gene expression was calculated according the method of 2
Ct, as described in the manufacturers instructions, and the accompanying software (RQ, ver. 1.3; Applied Biosystems, Inc.). Results for each animal were the mean of three experiments. The percentage decrease of Thy1 expression relative to the control was calculated in all samples. The data obtained for each treatment were pooled, and a total percentage decrease was calculated (see Fig 6 ). A Students t-test P < 0.05 was performed for the evaluation of significance.
|
|
|
|
|
|
The uptake of 1 µM [3H]AEA (223 Ci/mmol; Perkin Elmer Life Sciences Boston, MA) by the AMT was measured at 37°C in synaptosome-like vesicles, prepared from rat retinas (four per test) as already described.42 To discriminate noncarrier-mediated from carrier-mediated transport of AEA through synaptosome-like vesicles, control experiments were performed at 4°C, and the results were subtracted from those at 37°C.18 42 AMT activity was expressed as picomoles AEA taken up per minute per milligram protein.
The hydrolysis of [3H]AEA by fatty acid amide hydrolase (E.C. 3.5.1.4; FAAH) was assayed in rat retinas (three/test) homogenized (UltraTurrax T25; Fisher Scientific), as described for NAPE-PLD.41 The homogenates (20 µg/test) were incubated at pH 9 with 2 µM [3H]AEA, and the release of [3H]AA was measured by means of RP-HPLC, as reported elsewhere.43 FAAH activity was expressed as picomoles AA released per minute per milligram protein.
Binding to Cannabinoid and Vanilloid Receptors
For cannabinoid receptors studies, membrane fractions were prepared from rat retinas (eight/test) as reported,43 and were stored at 80°C for no longer than 1 week. Membrane fractions (50 µg/test) were used in rapid-filtration assays with the synthetic cannabinoid [3H]CP55.940 (400 pM, 126 Ci/mmol; Perkin Elmer Life Sciences) as described previously.43 Also, binding of 400 pM [3H]-resinferatoxin (RTX, 43 Ci/mmol; Perkin Elmer Life Sciences) to TRPV1 receptors was evaluated by rapid filtration assays, performed as already described.39 In all experiments, unspecific binding was determined in the presence of 1 µM cold agonist (i.e., CP55.940 or RTX for CB or TRPV1 receptors respectively).39 43 Receptor binding was expressed as femtomole ligand bound per milligram protein.
Analysis of Protein Expression
In a preliminary Western blot analysis of rat retinas (20 µg/lane), performed as reported,41 rabbit anti-FAAH (Primm Srl, Milan, Italy) and anti-CB1R polyclonal antibodies (Cayman Chemicals, Ann Arbor, MI) (each diluted 1:250), or anti-TRPV1 antibody (1:500; Santa Cruz Biotechnology, Santa Cruz, CA), were found to recognize a single immunoreactive band with the expected molecular size of FAAH (
66 kDa), CB1R (
56 kDa), and TRPV1 (
95 kDa) (data not shown). In all Western blot analyses goat anti-rabbit alkaline phosphatase conjugates (GAR-AP, diluted 1:2000; Bio-Rad Laboratories, Hercules, CA) were used as the second antibody. These findings extend to rat retina recent observations in other tissues.43 The same antibodies were used at the same dilutions to determine FAAH, CB1R, and TRPV1 protein content by enzyme-linked immunosorbent assay (ELISA), coating wells with cell extracts (20 µg/well), as reported. Nonimmune rabbit serum (Primm Srl) was used as control of specificity.41 The absorbance values at 405 nm (A405) of unknown samples were within the linearity range of calibration curves drawn with different amounts of extracts (range, 050 µg/well).
Endogenous Levels of Anandamide
For the evaluation of endogenous AEA levels, rat retinas (six/test) were homogenized (Ultra Turrax T25; Fisher Scientific), as described for NAPE-PLD, in the presence of 1 mM phenylmethanesulfonylfluoride, a FAAH inhibitor.41 Lipids were then extracted43 and the organic phase was dried under nitrogen. Dry pellet was resuspended in 20 µL methanol and was processed and analyzed by HPLC with fluorometric detection,44 as reported.43 The concentration of AEA in the unknown samples was determined by comparison with known amounts of authentic AEA, and was expressed as picomoles per milligram protein.
Statistical Analysis
Data are reported as the means ± SD or SEM, as indicated, of the number (n) of independent experiments reported in the figure legends. Statistical analysis was performed by the nonparametric Mann-Whitney test, or by the parametric Students t-test, as indicated. Experimental data were elaborated by means of commercial software (InStat 3 program; GraphPad Software for Science, San Diego, CA), and differences were considered statistically significant at P < 0.05.
| Results |
|---|
|
|
|---|
230% of the level in sham-procedure eyes (Fig. 1) . As expected, control FAAH activity was fully inhibited by the selective FAAH inhibitor URB597,36 used at 10 nM (Fig. 1) . Ischemia-reperfusion did not affect significantly the activity of the AEA-synthesizing enzyme NAPE-PLD, nor did it affect the transport of AEA by AMT (Fig. 1) . The latter carrier was fully blocked in the control samples by the selective AMT inhibitor OMDM1,45 used at 5 µM (Fig. 1) , whereas the lack of specific inhibitors of NAPE-PLD did not allow further extending the inhibition experiments. The ischemia-reperfusion paradigm also reduced to
25% of the control samples the endogenous levels of AEA (Fig. 1) , suggesting that the ischemic insult reduces the endogenous tone of retinal AEA by enhancing its degradation, without affecting synthesis or transport of this endocannabinoid.
We also checked whether retinal membranes were able to bind the synthetic cannabinoid [3H]CP55.940, which has high affinity to both CB1 and CB2 receptors.3 38 Retinal membranes were able to bind [3H]CP55.940 (Fig. 2) , which was displaced by the selective CB1R antagonist SR141716, but not by the selective CB2R antagonist SR144528.3 38 Moreover, retinal membranes were able to bind [3H]RTX, a specific TRPV1 agonist,39 and 1 µM capsazepine, a selective antagonist of vanilloid receptors,39 fully displaced this binding (Fig. 2) . Taken together, these findings suggest that retinal cells express type-1 cannabinoid receptor and TRPV1 receptor, thus adding biochemical support to previous immunochemical data.20 21 Of note, high IOP-induced ischemia followed by 12-hour reperfusion reduced to
60% the ligand-binding ability of both CB1 and TRPV1 receptors (Fig. 2) , thus paralleling the reduction of their endogenous agonist AEA (Fig. 1) .
We sought to extend our study by assessing the time course of the changes of the elements of the endocannabinoid system that were affected by retinal ischemia-reperfusion. To this end, reperfusion was performed for different periods (024 hours), after 45 minutes of high IOP, and then FAAH activity, CB1R binding, or TRPV1 binding were assayed. FAAH activity was found to increase as early as 3 hours after reperfusion began, reaching a significant increase (
150%; P < 0.05) after 6 hours (Fig. 3) . CB1 and TRPV1 receptors began to decrease after 3 hours of reperfusion and reached statistical significance (
70%; P < 0.05) at 6 hours (Fig. 3) . After 12 hours of reperfusion, FAAH showed its maximum increase (up to
230%), whereas CB1 and TRPV1 decreased down to
60% compared with the control samples, with no further changes in the following 12 hours (Fig. 3 , and data not shown). We next investigated whether the effect of ischemia-reperfusion could be due to the modulation of gene expression at the protein level. Therefore, we measured FAAH, CB1R, and TRPV1 proteins by ELISA. We found that high IOP followed by 12 hours of reperfusion induced changes in levels of FAAH (up to
180% of the control), CB1R, and TRPV1 proteins (both down to
60%), that were parallel to the changes of their activity or binding, respectively (compare Figs. 3 and 4 ). On this basis, it can be concluded that ischemia-reperfusion modulates FAAH, CB1R, and TRPV1 gene expression at the translational level.
We have reported that high IOPinduced ischemia followed by different intervals of reperfusion is associated with a progressive loss of cells in the RGC layer, characterized by apoptotic features.46 In this context, it should be recalled that the endocannabinoid system plays manifold roles in cell proliferation and programmed death.47 Therefore, to ascertain whether the observed changes in FAAH activity, and hence AEA levels, may be relevant for retinal damage caused by ischemia-reperfusion, we investigated the effects of URB597 on retinal cell survival. To this end we performed both cell counting in the RGC layer and RT-PCR for the measurement of retinal mRNA levels of Thy-1, which provides a sensitive and reliable index of RGC injury.48
Systemic administration of URB597 (0.3 mg/kg, IP) was able to reduce FAAH activity of ischemicreperfused retinas down to
35% of the control (Fig. 5) . Under these experimental conditions, URB597 reduced cell loss in the RGC layer (Table 1) and the decrease in Thy-1 mRNA levels (Fig. 6) , assessed after 24 hours of reperfusion. These data suggest that reduction of endogenous AEA levels, due to increased retinal FAAH activity, may play a role in retinal damage induced by ischemia-reperfusion. To further test this hypothesis, MetAEA (5 µL, 1 mM) was administered by intravitreal injection, 30 minutes before the ischemic insult. This treatment significantly counteracted cell loss (Table 1) and Thy-1 mRNA reduction (Fig. 6) after 24 hours of reperfusion. The neuroprotective effect of MetAEA was prevented by pretreatment with the selective CB1R antagonist SR141716 (3 mg/kg, IP), and also by the selective TRPV1 antagonist capsazepine (10 mg/kg, IP), as shown in Table 1 , Figure 6 . In addition, MK801 (0.3 mg/kg, IP), a noncompetitive antagonist of N-methyl-D-aspartate (NMDA) receptors, reduced retinal FAAH activity to
65% of control activity (Fig. 5) . It is worth noting that under similar experimental conditions MK801 has been shown to prevent cell loss in the RGC layer caused by high IOP,46 thus suggesting that excitotoxic stimuli may affect the metabolism of endocannabinoids in the mammalian retina.
|
| Discussion |
|---|
|
|
|---|
High IOP-induced ischemia is a valuable animal model for studying retinal ischemia.33 34 In particular, in this experimental paradigm, preferential damage occurs at the level of the RGC layer, similar to that reported in human glaucoma.35 Therefore, IOP-induced retinal ischemia also represents a relevant model of acute glaucoma. We have recently shown that elevated glutamate concentrations, glutamate receptor activation, and increased nitric oxide synthase activity contribute to the mechanism of high IOP-induced cell death in the rat retina.46 This seems of interest, because plant-derived cannabinoids such as THC and cannabidiol, have been shown to prevent retinal neurotoxicity, by reducing the formation of these compounds on in vivo intravitreal injection of NMDA.49 In addition, CB1R-knockout mice have been reported to be more sensitive to inflammatory and excitotoxic insults than are wild-type littermates in an animal model of allergic uveitis, thus supporting a neuroprotective role for this receptor during eye neurodegeneration.22 Consistent with these findings, we showed in the present study that blocking degradation of the endogenous cannabinoid AEA or mimicking its effect by using the stable analogue MetAEA confers retinal neuroprotection against high IOPinduced cell death. Therefore, it is conceivable that an early decrease in endogenous AEA levels may underlie cell damage in the ischemicreperfused tissue. It seems noteworthy that IOP-induced reduction of AEA occurs through enhanced activity of FAAH, without significant effect on the activity of NAPE-PLD. This finding reinforces the concept that FAAH, by exerting a "metabolic control" of the endogenous tone of AEA, is the main regulator of its activity in vivo.8 50 Along the same line, these data identify FAAH as a potential therapeutic target for the treatment of IOP-related eye diseases, most notably glaucoma, and suggest that FAAH inhibitors like URB597 may become useful pharmacologic tools to counteract these diseases. Also CB1R and TRPV1 expression and ligand binding capacity are reduced by high-IOP ischemia-reperfusion. Stimulation of CB1 receptors can elicit either inhibitory effects by blocking glutamate release or excitatory effects by blocking
-aminobutyric acid (GABA) release, depending on which neuronal circuits are activated.3 Of interest in relation to the present findings is that the inhibition of glutamate release has been suggested to represent a pivotal mechanism involved in endocannabinoid-mediated neuroprotection.51 52 53 In the same line, cannabinoid receptor activation may prevent54 or induce55 apoptosis, implying that CB1 receptors represent a key regulator of cell survival and death. In contrast, TRPV1 activation triggers the opening of intracellular calcium stores, thus activating phospholipase C/inositol 1,4,5-triphosphate signaling that may contribute to the control of the cell fate.56 At any rate, independent of the underlying mechanism(s), our findings suggest that CB1 and TRPV1 receptors may be useful pharmacologic targets to control retinal death in IOP-related diseases, extending to the RGC layer previous observations in different models of AEA-controlled cell death.47
Unlike the reduction of endogenous AEA observed in high IOP-induced ischemia, an early increase of AEA has been reported in the whole brain of rats after transient57 or permanent58 focal brain ischemia, in neonatal rats exposed to an intrastriatal microinjection of NMDA,59 and in gerbils subjected to global brain ischemia.60 Endogenous levels of AEA are elevated also by kainate-induced neuronal excitation53 and middle cerebral artery occlusion (MCAo) in rats,57 or during stroke in humans.61 Of note, the elevation of AEA has been suggested to represent an endogenous protective mechanism during CNS injury.4 53 In line with this, exogenously administered (endo)cannabinoids have been shown to protect neurons via several mechanisms,62 yet the role of endogenously released endocannabinoids on neuronal damage has remained controversial.32 In fact, no protection by the CB1R synthetic agonist WIN 55212-2 was found in a rat pup model of excitotoxic forebrain damage.59 Moreover, several studies have reported that prolonged exposure to plant-derived CB1R agonists like THC or marijuana extracts altered the structure and function of the rat hippocampus, depending on doses, route of administration, duration of exposure, age, and animal species used.63 Furthermore, reduced levels of AEA, in association with increased FAAH expression and activity, have been observed in other models of neurotoxicity, such as HIV-1 glycoprotein 120 (gp120)-induced neurodegeneration.64 Taken together, it can be proposed that endocannabinoids play a widespread neuroprotective role against ischemic insults, yet their action occurs through multiple signaling pathways. Our present observation that NMDA receptors can control AEA degradation through FAAH (Fig. 5) seems to add a new dimension to this complexity.
In conclusion, we have shown that the rat retina has a functional endocannabinoid system and that high IOPinduced ischemia-reperfusion reduces the endogenous tone of AEA, by enhancing FAAH activity and expression. We also have shown that the expression and ligand-binding ability of CB1 and TRPV1 receptors is downregulated in ischemicreperfused retinas, and that this may induce cell loss in the RGC layer on ischemic insult. Taken together, these data seem to identify FAAH as a potential novel target for new therapeutics to be exploited for the treatment of such IOP-related eye diseases as acute glaucoma.
| Acknowledgements |
|---|
| Footnotes |
|---|
Submitted for publication November 10, 2006; revised February 2 and 16, 2007; accepted April 23, 2007.
Disclosure: C. Nucci, None; V. Gasperi, None; R. Tartaglione, None; A. Cerulli, None; A. Terrinoni, None; M. Bari, None; C. De Simone, None; A.F. Agrò, None; L.A. Morrone, None; M.T. Corasaniti, None; G. Bagetta, None; M. Maccarrone, None
The publication costs of this article were defrayed in part by page charge payment. This article must therefore be marked "advertisement" in accordance with 18 U.S.C.
1734 solely to indicate this fact.
* Each of the following is a corresponding author: Giacinto Bagetta, Department of Pharmacobiology and University Centre for Adaptive Disorders and Headache (UCHAD), Section of Neuropharmacology of Normal and Pathological Plasticity, University of Calabria, 87036 Rende, Italy; g.bagetta{at}unical.it. Mauro Maccarrone, Department of Biomedical Sciences, Piazza A. Moro 45, I-64100 Teramo, Italy; mmaccarrone{at}unite.it. ![]()
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
I. A. Khasabova, S. G. Khasabov, C. Harding-Rose, L. G. Coicou, B. A. Seybold, A. E. Lindberg, C. D. Steevens, D. A. Simone, and V. S. Seybold A Decrease in Anandamide Signaling Contributes to the Maintenance of Cutaneous Mechanical Hyperalgesia in a Model of Bone Cancer Pain J. Neurosci., October 29, 2008; 28(44): 11141 - 11152. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Iribarne, V. Torbidoni, K. Julian, J. P. Prestifilippo, D. Sinha, V. Rettori, A. Berra, and A. M. Suburo Cannabinoid Receptors in Conjunctival Epithelium: Identification and Functional Properties Invest. Ophthalmol. Vis. Sci., October 1, 2008; 49(10): 4535 - 4544. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||